Derivatives of purines and pyrimidines make up the base component of nucleotides. Select the positions in the purine ring of a purine nucleotide in DNA that have the potential to form hydrogen bonds but do not participate in Watson-Crick 6. base pairing. 7 С-6 N-1 8 CH С-5 HC. 9. С-2 C-8 Purine N-7 N-9 O O O O O O
Q: In one paragraph, using your own words, describe the structure of DNA. Be sure to include the…
A: Introduction :- DNA, or deoxyribonucleic acid, is a long, double-stranded molecule that contains the…
Q: Identify the correct name or abbreviation for the given nucleoside or nucleotide. guanosine ADP dADP…
A: Nucleosides are composed of a pentose sugar and a nitrogenous base.Nucleotides are composed of a…
Q: B. How many non-covalent hydrogen bonds stabilize this structure? 8 C. How many covalent phosphate…
A: The trinucleotide sequence is:5' - ACG - 3'The complementary trinucleotide sequence will be:3' - TGC…
Q: Draw a double-stranded DNA molecule (using different colors for each) model should clearly represent…
A: A G T A C C G G G C A A the sequence of DNA
Q: Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules,…
A: DNA (Deoxyribonucleic acid) and RNA (Ribonucleic acid) are two examples of nucleic acids. DNA and…
Q: Assume the energy of hydrogen bonds per base pair to be 5.86 kJ-mol-1. Given two complementary…
A: Given Energy of H-Bond per base pair = 5.86 kJ mol-1 Number of Base pair in complementary DNA = 145…
Q: Why can you not create a Ramachandran plot for RNA molecules? Is it possible to get a similar type…
A: Ramachandran plot is plot that describes the distribution of torsional angles called phi and psi of…
Q: The DNA sequence you use will be the following: T - A - G - C - C - A. You will need to make the…
A: chargaff's rule states that in DNA sequence in complementary strands the Adenine will form a bond…
Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…
A: The DNA double helix has alternating major and minor grooves. The major groove is wider than the…
Q: 5’ - A T G G C C C A A C T G A C C - 3’ a. How many nucleotides are listed here b. How…
A: Transcription is the process by which the genetic information encoded in DNA is copied into a…
Q: Mondoy Hemework DNA STRUCTURE OVERALL SHAPE BONDING bonds between ВАСКВONE GROUPSOF MOLECULESCALLED…
A: Every living organism contains genetic material in form of RNA or sometimes in form of DNA. The…
Q: Identify the base shown below. Drag the correct base to the rectangle in the image O HN H₂N Adenine…
A: Introduction :- Guanine is a nitrogenous base that is one of the four building blocks of DNA and…
Q: Much of the stability of the double-stranded DNA struture is the result of A-hydrogen bonding…
A: The stability of DNA means that the double-stranded helix through which the DNA is made would…
Q: The relative proportions of cytosine-guanine and adeninethymine bonds in a DNA sample can be…
A: Deoxyribonucleic acid (DNA) is the hereditary material that undergoes replication which is vital for…
Q: Would you expect the double helix in a short segment of DNA to be more stable in a storage solution…
A: DNA (deoxyribonucleic acid), is a very complex molecule and is the primary carrier of genetic…
Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…
A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…
Q: The sequence of the 15 bp fragment from the previous problem is repeated below: 5' TCTGAATTCCGTAGA…
A: DNA is a double-stranded molecule that is made of several nitrogen base pairs. The nitrogen base of…
Q: Choose all of the statements that correctly describe the base pairs drawn below. A C -O -H-N B D…
A: The four bases that make up DNA are adenine (A), cytosine (C), guanine (G), and thymine (T), while…
Q: Using the figure below, clearly identify which numbered component corresponds}to a purine, a…
A: DNA is the hereditary material in organism , it is responsible for expressing certain traits…
Q: Draw double-stranded DNA (two basepairs long with one AT basepair and one GC basepair). Your drawing…
A: Basic structure of DNA and the structure of different nitrogenous bases.
Q: Which of the following equations is a prediction based on Chargaff’s rules for the content of DNA?…
A: Chargaff's rule says that DNA should have 1:1 ratio of pyrimidines and purine bases. According to…
Q: A-DNA is a double-stranded form of DNA that has a helical radius and helical pitch compared to the…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: Select the chemical consequences that could contribute to DNA instability at AP sites. fewer…
A: An apurinic/apyrimidinic site or abasic site can be created as a result of DNA damage or as a part…
Q: A circular double-stranded DNA molecule contains 4200 base pairs. Insolution, the molecule is in a…
A: The degree of super coiling in a DNA molecule is termed as supercoiling density. It is denoted by…
Q: otal nucleic acids are extracted from a growing culture of yeast cells. They are then mixed with…
A: Although ssDNA could be a critical intermediary in practically all biological activities involving…
Q: If you analyze a double-stranded DNA molecule and find that 15% of all the nucleotide bases are…
A: According to Chargaff's rule, [A]+[G]=[C]+[T] where A - adenine G - Guanine C- Cytosine T- Thymine
Q: Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G]= [C], equalities now…
A: Erwin Chargaff proposed two rules which are termed as Chargaff's rule. These rules played an…
Q: 5'G-A-T-A-C-А-А-с-А-т-G-G-A-с-A-T-G-A-с-т3' What would be the first 3 bases in the 5' end of the…
A: In DNA four types of nitrogenous bases are found in which adenine (A) is complementary with the…
Q: ns: In each box, type the hrst letter of the base that correctly matches the given DNA sequences C…
A: Answer. A nucleotide is the monomeric unit of nucleic acids. Nucleic acids are therefore also called…
Q: a) It is known that double stranded DNA is denatured at low pH. pKa…
A: When a DNA solution is heated enough, the double-stranded DNA unwinds and the hydrogen bonds that…
Q: The sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence…
A: Introduction DNA denaturation, sometimes called DNA denaturing, is the conversion of…
Q: For a closed-circular DNA molecule of 6,825 base pairs in the fully relaxed form, the linking number…
A: In simple words, the linking number represents the number of times a curve winds around another. The…
Q: Fill in the missing bases below to show the correct complementary base pairing. 5' 3'
A: In molecular biology Complementary base pairing or complementarity is a relation between two…
Q: a) Draw the A-T and G-C base pairs. - Label the bases…
A: DNA are polymers of nucleotides. A nucleotide consists of a nitrogenous base(A, T, G, C) attached to…
Q: How do I identify which nitrogenous base is which in a DNA and RNA polymer? I am looking at a 2D…
A: A nitrogen base is an organic molecule with a nitrogen atom that has chemical properties of being a…
Q: here is a chemically synthesized DNA oligonucleotide is 5’–AUCG–3’. Please draw the all-atom…
A: DNA contains nitrogenous bases A, T, G and C while RNA contains A, U, G and C. RNA is synthesised…
Q: Match the following terms with their correct definition. The structure of double-standed DNA Hold…
A: Monomers are the simpler units which joins to each other to make polymers. There are many polymers…
Q: Which statements reflect the Watson-Crick model of DNA? Select all that apply. The strands of DNA…
A: Watson and crick model describes the double-helical coiled structure of the DNA.
Q: Draw the structure of the following DNA sequence (5’-AG-3’) hydrogen bonded through Watson-Crick…
A: Nucleotides are molecules that have a nitrogenous base (Adenine, Thymine, Guanine, Cytosine and…
Q: 6. a.) Which part (sugar, phosphate, or nitrogenous base) of the four types of nucleotides differ?…
A: Nucleosides contain only sugar and a base whereas Nucleotides contain sugar, base, and a phosphate…
Q: 2. One of the key pieces of information that Watson and Crick used in determining the secondary…
A: Deoxyribonucleic acid i.e DNA is the molecule that carries our genetic information to the next…
Q: QUESTION 1 For the DNA structure below write the correct base sequence in the form: 5'-ATCT-3…
A: Question 1. Nucleic acids are the genetic material of the cell and are composed of recurring…
Q: Cytosine makes up 42% of the nucleotides in a sample of DNA from an organism. The composition of the…
A: Introduction : The DNA molecule which is the genetic material found in all living organisms, is made…
Q: Draw the structure of the standard Watson-Crick base-p airs involving the nucleotides dAMP,dGMP,…
A: DNA consists of polymer of deoxyribonucleotides and the monomeric deoxyribonucleotides in DNA…
![Derivatives of purines and pyrimidines make up the base
component of nucleotides.
Select the positions in the purine ring of a purine
nucleotide in DNA that have the potential to form
H.
hydrogen bonds but do not participate in Watson–Crick
6
base pairing.
N
С-6
N-1
8 CH
C-5
12
HC
4
9
С-2
N.
H
С-8
Purine
N-7
N-9
N-3
O C-4
O O](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F9e9c20b4-187f-45f1-9339-cd8710eefa95%2F4d25ec9f-7a6c-4889-8fad-b192a66a22c2%2Fj83kcsp_processed.png&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Molnupiravir causes widespread mutations as SARS-CoV-2 replicates its genome because in an RNA double helix molnupiravir can base pair with more than one base. Shown below are the structures the RNA bases. With which two bases does molnupiravir pair? H N-H Adenine NH-N Uracil H H-N N-HN N-H Guanine H Cytosine A. The "imino" form pairs with A; the "amino" form pairs with G. B. The "imino" form pairs with G; the "amino" form pairs with A. C. The "imino" form pairs with U; the "amino" form pairs with C. D. The "imino" form pairs with C, the "amino" form pairs with U.If hypoxanthine (structure shown) was incorporated into double stranded DNA, what would it most likely base-pair with, in accordance with the Watson-Crick pairing. N- Adenine Guanine Cytosine . thymine uracil ZIHN N C N H₂N HN پرسپولیو D B CH₂ -N N NH₂ E When part of a nucleotide in a nucleic acid chain, which of the following may base pair with thymine nucleotides? Choose all correct answers and assume normal Watson-Crick base pairing.
- Choose all of the statements that correctly describe the base pairs drawn below. A C H H-N -H-N N-H- -N B H D موعة Rita N -H---- 2 NHN O- -H-N H -H- N- -H-N The non-Watson-Crick base pair shown in A is much less stable than the base pairs shown in B and C, because the smaller size of the two pyrimidine bases induces a distortion in the structure of the double helix that decreases the stability of the helix when compared to helices with the normal Watson-Crick base pairs. The base pair shown in B is found in BOTH DNA and RNA The base pair shown in C is found ONLY in RNA and NOT DNA The base pair seen in B is more stable than the Watson-Crick base pair shown in C partly because of a larger number of hydrogen bonds and partly because of more favourable pi-stacking interactions with adjacent base pairs.A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: G G C T A G C T G C T T C C T T G G G G A C C G A T C G A C G A A G G A A C C C C T Template strand with its polarity: 3’ C C G A T C G A C G A A G G A A C C C C T 5’ - Coding strand with its polarity: 3’ G G C T A G C T G C T T C C T T G G G G A 5’ Please write out the mRNA sequence generated by the template strand to produce that polypeptide chain.The sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'
- Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'An exonuclease is an enzyme that sequentially cleaves nucleotides from the end of a polynucleotide strand. Snake venom phosphodiesterase, which hydrolyzes nucleotides from the 3′ end of any oligonucleotidewith a free 3′-hydroxyl group, cleaves between the 3′ hydroxyl of the ribose or deoxyribose and the phosphoryl group of the next nucleotide. It acts on single-stranded DNA or RNA and has no base specificity. This enzyme was used in sequence determination experiments before the development of modern nucleic acid sequencing techniques. What are theproducts of partial digestion by snake venom phosphodiesterase of an oligonucleotide with the sequence (5′)GCGCCAUUGC(3′)—OH?Draw the structure of the following DNA sequence (5’-AG-3’) hydrogen bonded through Watson-Crick base pairing to the complementary PNA sequence (Cterminus-TC-Nterminus). Make sure to include both the sugar phosphate backbone of your DNA sequence, as well as the peptide backbone of your PNA sequence. DNA: 5’-AG-3’ PNA: (C)-TC-(N)
- Hydrolysis of the N-glycosyl bond between deoxyribose and a purine base in DNA creates an apurinic (AP) site. An AP site is more thermodynamically destabilizing to a DNA molecule than is a mismatched base pair. Examine the structure of an AP site. H₂N HN N O™ -O-P-O-CH₂ Guanine H₂N N HN Select the chemical consequences that could contribute to DNA instability at AP sites. H H 1₂0/ H fewer hydrogen bonds between the unpaired pyrimidine base and water disruption of the base-stacking interactions decreased interaction between the mutated DNA strand and histones increased ability of the deoxyribose ring to open without the attachment of the purine base H H Guanosine residue (in DNA) O™ -O-P-O-CH₂ O H H H O Apurinic residue H OH HSnake venom phosphodiesterase hydrolyzes nucleotides from the 3' end of any oligonucleotide and cleaves between the 3' hydroxyl of the ribose or deoxyribose and the phosphoryl group of the next nucleotide. It acts on single-stranded DNA or RNA and has no base specificity. Which nucleotide would be released first from the oligonucleotide shown below upon treatment with snake venom phosphodiesterase? choices a. Deoxythymidine 5'-monophosphate b. Deoxyguanosine 3'-monophosphate c. Deoxyguanosine 5'-monophosphate d. Guanosine 5'-monophosphate e. DeoxythymidineDescribe the d=features of the following DNA-binding domains and how they interact with DNA. Helix-turn-Helix Zinc Finger Leucine Zipper Helix-loop-Helix
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)