Crime Scene Investigation: Cindy was attacked by a masked assailant but she managed to scratch him and get away. Three suspects were apprehended and their DNA samples were cut by the same restriction enzyme and then run through a gel. 1. Whose DNA matches the skin under Cindy's fingernails? 2. Why do some DNA piecestravel farther in the gel than others? 3. Why is important to use the same type of restriction enzyme when cutting all the DNA samples? Skin undem Fingernail Cindy's DM Suspect X Suspect Y Suspect Z

Crime Scene Investigation: Cindy was attacked by a masked assailant but she managed to scratch him and get away. Three suspects were apprehended and their DNA samples were cut by the same restriction enzyme and then run through a gel. 1. Whose DNA matches the skin under Cindy's fingernails? 2. Why do some DNA piecestravel farther in the gel than others? 3. Why is important to use the same type of restriction enzyme when cutting all the DNA samples? Skin undem Fingernail Cindy's DM Suspect X Suspect Y Suspect Z

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter14: Biotechnology And Society

Section: Chapter Questions

Problem 9QP

See similar textbooks

Similar questions

Paternity Test: Alanna claims John is the father of Timmy, but Leo thinks that he is the father. All of their DNA samples were taken and cut with the same restriction enzyme and run through a gel. 4. Who is the father of Timmy? 5. How many of Timmy's fragments are the same size as his mother's fragments? 6. Whatactually causes the DNA pieces to move through the gel? 7. Describe the difference you see in the gel between John's DNA and Leo's DNA. Alanna's DNA Timmy's DNA John's DNA Leo's DNA
DNA Sample : Blood Stain collected from handle of knife blood Bob Sue John Lisa stain 1. What do you notice about the black lines? 2. How do we read the gel electrophoresis? 3. Which sample are we comparing Bob, Sue, John, and Lisa's DNA to? 4. How do they compare?
How is the DNA used for catching crime suspects. Describe the procedure and cite particular example where it helped solve a case or absolved an innocent person from any wrongdoing
DNA is visualized during agarose gel electrophoresis by ______________ . the fact that DNA fluoresces when illuminated with UV light the binding of a fluorescent dye that is easily detectable using radioactive antibodies that specifically bind to DNA the fact that DNA is blue and can be seen when millions of copies are present in a band
DNA EXTRACTION Materials: knife 1 cup of fruit Table salt clean piece of cloth or strainer for filtering resealable bag dishwashing liquid 70% rubbing alcohol (chilled) shot glass (or any transparent and narrow container resembling a test tube) How to do the extraction: Before you begin, make sure you have chilled your alcohol in the freezer for at least 3 hours. Room temperature alcohol will not work nearly as well as cold alcohol. Place about 50 mL of alcohol in the freezer to chill it and take it out only when you’re going to need it. (The alcohol will not actually freeze.) 1. The first thing you will need is a sample. Since DNA is found in all living…
If you were to re-do this lab again with the same basic constraints (one DNA source, multiple enzymes), what would you do to make the gel a clear, readable DNA fingerprint? Would you change any restriction enzymes? Would you run the gel longer? Explain.
DNa Mapping using Restriction enzymes lab: We will be aliquoting and delivering 5 μl of enzyme to each of the experimental tubes. What would happen if you underloaded the enzyme? i.e. you only delivered 3 or 4 μl ? What would see in your gel results?
QUE Marker CS1 CS2 J DNA1 DNA1 DNA2 DNA2 Enz 1 Enz2 Enz1 Enz2 [[ 1 1 11 JI Marker TE HC (CC Compare the two suspects DNA Samples from tubes 4 and 3 with the crime scene samples CS1 these were all cut with Restriction enzyme 1) Then compare the suspects DNA from tubes 2 and 4 with the crime scene sample CS2 (all cut with Restriction enzyme 2) om AUT Figure 7.2 Example gel image of suspect and crime scene samples. Samples were digested with restriction enzymes and run on a 0.8% gel. Please note that the markers used in this experiment may not match the markers in this figure.
Match the item to its best description or use. Agarose 1. produces DNA fragments RFLP 2. important tools; used to load samples into electrophoresis gels 3. small circular chromosomes in Comb bacteria 4. region of DNA that produces Micropipette different band sizes when cut with restriction enzymes Restriction Enzyme 5. produces wells in the gel where samples are added gel chamber 6. container where gel is placed to Stain or dye 8. Plasmid DNA introduce the electrical current 7. used to produce the actual gel used to visualize the otherwise colorless DNA bands
HEADGEAR PHYSICAL DESCRIPTION OF PERPETRATORS PERPETRATOR A. Stocking Cap 1. B. Cowboy Hat C. Baseball Cap PERPETRATOR D. Ski or Watch Cap E. Skull Cap F. Beret/Military G. Straw Hat or Fedora H. Masked OUTERWEAR A. Sweatshirt or Jogging Jacket B. Leather, Suede or Fur Trimmed C. Military D. Ski Jacket Gang, Team or School Jacket 2. E. F. Sweater or Vest G. Overcoat or Topcoat H. T-Shirt or Tank Top OTHER CLOTHING ACCESSORIES HEADGEAR COLOR (see color codes below) PERPETRATOR 1. 2. OUTERWEAR COLOR (see color code below) PERPETRATOR 1. 2. PERPETRATOR A. Messy/Dirty/Torn Clothes H. Dress/Skirt B. Well Dressed 1. Scarf/Bandana C. Slacks J. Jewelry (specify) 2. PERPETRATOR D. Shorts E. Jeans F. Uniform/Work Clothes G. Sweat/Jogging Pants FOOTWEAR K. Tools or Keys L. Bag or Briefcase M. Glasses 1. 2. 1. 2. PERPETRATOR A. Jogging Shoes B. Dress Shoes C. Work or Hiking Shoes D. Cowboy Boots E. Sandals F. Barefooted IMPERSONATION OF: A. Law Enforcement Officer B. Security Guard C. Male D.…
Can you explain thie each of the statement given i dont really understand the dna recombinant is used as a molecular cloning and application for recombinant dna
Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will travel the furthest? BAM HI: GGATCC CCTAGG AATCGGATCCATTTGGACTAAAGGACCCGGATTGGATCCAGGGCCTTTAGTACC TTAGCCTAGGTAAACCTGATTTCCTGGGCCTAACCTAGGTCCCGGAAATCATGG O 3 O 2 4. 1.