8. The DNA shown below will be used as a template for a PCR reaction. The arrows below the template are spaced 10 base pairs apart to assist you with counting. 5 GTCTGTTAGCCATAGTTTCCCTATCCATCGACCTGAAAATCGGTATCTGGACTTTTAAGT 3' 3' CAGACAATCGGTATCAAAGGGATAGGTAGCTGGACTTTTAGCCATAGACCTGAAAATTCA 5' What will be the length (in base pairs) of the double-stranded target PCR product after 30 rounds of PCR using the following two primers? Primer 1: 5' ATTTTCAGGT 3' Primer 2: 5' TTAGCCATAG 3'

Q: How Plants and animals reproduce.

A: The process of reproducing individuals of the same species is known as reproduction. The majority of…

Q: Write an essay with introductions and two body paragraphs and a conclusion.

A: Biology is the investigation of every single living being. Directly from the littlest green growth…

Q: Eukaryotic cells means

A: Prokaryotic and Eukaryotic are the two broad categories in which cells can be categorized based on…

Q: What is the Similarities between the story of Henrietta lacks and the Tuskegee experiment? Don't for…

A: Henrietta Lacks as well as her immortal HeLa cells have been a landmark of clinical research for a…

Q: what is science

A: Humans have been known for observing, discovering, searching for various things present in their…

Q: Why is a theory more comprehensive than a conclusion?

A: Introduction Scientific method is the process of systematizing and extending the understanding of…

Q: Deductive thinking vs inductive thinking: Which is a better method? Five paragraphs ONLY NO…

A: Both inductive and deductive thinking are useful techniques for reasoning, each having certain…

Q: What is science

A: One of the important fields of education and research is called science. There are many ways in…

Q: What is zoology

A: Science is the process of studying and understanding the natural world through experiments,…

Q: Identify the structure: (1 Answers 1-1 1.

A: The structure made up of nervous tissue, starting from the medulla portion of the brainstem and…

Q: Compare inductive reasoning with deductive reasoning.

A: DEDUCTIVE REASONING *It is known as top-down approach. *General order of deductive reasoning is…

Q: Moving from a general principle which everyone agrees with to prove a specific conclusion through…

A: The term "reasoning" is a process of inferring or forming conclusions using logic or reason. It…

Q: why is it important for scientists to state a conclusion?

A: Conclusion: A conclusion is a brief statement that summarises the general findings of an experiment…

Q: Over time, a child gets bit by several different kinds of snakes and becomes ill each time. The…

A: One thing all forms of science have in common is the ultimate goal of "knowing." Curiosity and…

Q: Which statement best describes the diagrams shown?  https://images.app.goo.gl/

A: Cell division is a process in which cell elongates and divides into two daughter  cells. It is very…

Q: True or false: A cell's identity is fixed and can not be changed.

A: Our human body consists of trillions of cells each performing its unique function and at the start…

Q: The rough endoplasmic reticulum is studded with _______________, which serve as a site…

A: Introduction: The cell is regarded as the fundamental unit of life as all tissues and can equate any…

Q: what is science

A: Any pattern of understanding about and implying impartial observations, methodical experiments, the…

Q: Each organism is considered an autonomous self-organizing self-maintaining entity. This set of…

A: Each organism is considered an autonomous organising self-maintaining entity. This set ofproperties…

Q: Identify any 10 of the labeled structures. Select five and explain the function of each.

A: The given images show male and female human reproductive systems and various parts and associated…

Q: What is environment

A:

Q: Where we can use biochemistry

A: The study of chemical processes within and relating to live beings is known as biochemistry, or…

Q: what is science

A: Science is the action or application of knowledge of natural or artificially produced world which is…

Q: A good hypothesis requires a testable ___________ that is ___________.

A: A hypothesis is a conditional explanation that proposes a possible clarification to some phenomenon…

Q: Identify this organism by genius name

A: Microbes are extremely minute living entities which are everywhere and are invisible to the unaided…

Q: Can you help find the answer please

A: Columnar epithelial cells are simple epithelium made up of columnar cells. They are usually taller…

Q: What is science

A: Science is what we observe around us. Science is a very wide subject. Everything that we observe,…

Q: Contrast three approaches to problem solving.

A: Nursing practice includes the roles, activities, functions, and responsibilities that a registered…

Q: how important it is to understand and appreciate the biologist's contribution to your knowledge…

A:

Q: Are there current scientific developments

A: Humans through ages have developed many scientific theories which led to more understanding of our…

Q: Ten important of biology

A: Known as 'the science of life', Biology is a fascinating, practical science that explores all living…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.