Cargaff rules tells us if we know the amount of one nucleobase for an orgnaiss DNA, we can deterine each of the oter. Can te same be said for a organisms RNA. Explain.

Q: Imagine two DNA duplexes X and Y. According to calculations using the nearest neighbor method the…

A: Given two DNA duplexes.  X and Y Standard enthalpy of helix formation is same for both.  Standard…

Q: From the previous question regarding the insertion of an A base into the template strand: will this…

A: The transcription is the process of RNA synthesis from the DNA template. It is the first step of…

Q: DNA replication occurs during S phase. This lasts 6-8 hours in mammalian cells and only about 40…

A: DNA replication is the process by which new DNA is synthesized from the old DNA in semiconcertative…

Q: Match the features to the labeled parts (Some may be used mutliple times, and not all labeled names…

A: Answer. A -  N terminus- A polypeptide synthesis proceeds from N- terminus to C-terminus and…

Q: Double-helical DNA has major and minor grooves because

A: The question is regarding DNA double helix structure. The structure of a DNA molecule is described…

Q: 3a please in simple language

A: Introduction  A important historical experiment that showed DNA replication's semi-conservative…

Q: Figure 2 represents part of a DNA molecule. -3' G T 5' T АTGC Ттс с АGT TACG AAGG TCA 3' стТ C ure 2

A: DNA is a nucleic acid, one of the four major groups of biological macromolecules. All nucleic acids…

Q: 1. When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain…

A: Griffith experiment  In 1982,  Frederick Griffith performed an experiment to prove that cells…

Q: 5'- What will be the Sanger products of the DNA with base sequence ACGTCGACTCCGGTC-3'

A: DNA sequencing is the biochemical method used for determining the order of nucleotide bases, A, G,…

Q: If a person is lacking a gene that codes for a protein involved in nucleotide excision repair, then…

A: DNA can experience a variety of chemical reactions, as in any other molecule. However, since DNA is…

Q: AGTGCATTTCCAGGGA Above is a randomly generated sequence of DNA 16 bp long. Determine the Tm of this…

A: The Temperature of Melting (Tm) is defined as the temperature at which 50% of double stranded DNA is…

Q: If we repeated the Messelson Stahl experiment but we started with NN 4 then transgressed to NON…

A: Meselson Stahl experiment is an experiment performed by Matthew Meselson and Franklin Stahl in 1958…

Q: Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However,…

A: Nucleotides are the molecules composed of a sugar moiety, phosphate group, and a nitrogenous base.…

Q: Out of the 4 base pairs that are shown, B and C are the ONLY Watson-Crick base pairs that are found…

A: The four bases that make up DNA are adenine (A), cytosine (C), guanine (G), and thymine (T), while…

Q: Assume that a viral DNA molecule is a 50@μm-long circularstrand of a uniform 2-nm diameter. If this…

A: A virus is sub-microscopic infectious agent that replicates only inside the living cells of an…

Q: Yes, all mutations change the resulting protein. No, the amino acid sequence has not been changed.…

A: Deoxyribonucleic acid (DNA) is the material that carries inheritable information to the succeeding…

Q: Write out the resulting DNA molecules after the following double stranded DNA molecule is digested…

A: DNA stands for deoxyribonucleic and. It is the genetic material present in the cell.

Q: Bacteriophage T7 helicase movesalong DNA in the 5' -to-3' direction.Other helicases have been…

A: it is a DNAB protein it is a hexamer of identical subunit they clamp around each of the two single…

Q: During DNA replication, an incoming nucleotide is enzymatically joined to the preceding nucleotide…

A: Phosphodiester bond Explanation:-In DNA and RNA, the phosphodiester bond is the linkage between the…

Q: What is the nucleotide sequence of the complementary strand of this molecule AT GCGA? O CATAG O A AT…

A: Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are well known and well defined as the two…

Q: Do not use Ai

A: Rules for finding the complementary RNA molecule given a DNA sequence:Convert the A's into…

Q: If a person os homozygous for the presence of an ALU repeat in the PV92 region you would expect the…

A: Homozygous refers to the presence of the same type of allele on a particular locus.

Q: he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof…

A: Replication is the biological process in which a single copy of DNA is duplicated into two copies…

Q: The electrical current created during gel electrophoresis forces DNA to move from the negative end…

A: Answer.  DNA or Deoxyribonucleic acid is made up of nucleotides. A nucleotide contains a phosphate…

Q: What molecular biology strategy can best be used to determine Inhibition of DNA synthesis? Explain.

A: DNA replication is very important and essential biological activity to produce two copies of DNA…

Q: Here is the amino acid sequence of part of a hypothetical gene you want to clone:…

A: a.The amino acid sequence Tyr-Met-Cys-Trp-Ile will make a 14-mer probe with the least degeneracy as…

Q: which type of base pairs uf any allow the dna to remain double dtranded at higher temperature? gc…

A: DNA is the main store house of genetic information in our body. DNA condensed to form chromosome,…

Q: Phosphate Sugar G A Bases O CCCACTTGAG O GAGTTCACCC O GGGTGAACTC OCTCAAGTGGG O None of the Above…

A: Nucleic acids are biomolecules that store genetic information and help pass it from one generation…

Q: In Noll’s experiment , explain where DNase I cuts the DNA. Why were the bands on the gel in…

A: Deoxyribose Nucleic Acidase (DNAase) I was utilized to test the higher request chromatin structure…

Q: The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If…

A: DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A),…

Q: Given this sequence ATGCACCG About how often (every _____ bases) would this occur in double strand…

A: All DNA strands are made up of nucleotides namely Adenine (A), Thymine (T),  Guanine (G), and…

Q: In Figure 7-7, do you recognize any of the componentsused to make Watson and Crick’s DNA model?…

A: DNA is made up of nucleotidea. Each nucleotide is made up of a phosphate group, dexy ribose pentose…

Q: Which of these sequences has dyad symmetry? O 5' AATGCTTATCGTAA 3' O More than one of the above O 5'…

A: Dyad symmetry refers to two areas of a DNA strand whose base pair sequences are invertead repeats of…

Q: Question 3 son and Stahl on DNA replication, if the cells are cultured for many generations in a…

A: Introduction: DNA is a genetic material for all living organisms, except some viruses.

Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…

A: Gene is a part of the DNA, located on a specific site on the chromosome and has a specific sequence…

Q: Which enzyme replicates DNA at a faster rate, E. coli DNA Pol III or mammalian DNA Pol δ? Also…

A: DNA polymerase δ (Pol δ) is involved in various processes such as; catalyze the replication of the…

Q: The electrical current created during gel electrophoresis forces DNA to move from the negative end…

A: Electrophoresis is  a technique used in biotechnology  and molecular biology to separate small…

Q: Can you explain this dna model

A: DNA is made up of sugar ( deoxyribose) , nitrogenous bases ( thymine, cytosine, adenine and guanine)…

Q: Calculate the electric fields and net force between a thymine and an adenine pair. = Calculate the…

A:

Q: which of the follocoing waeleng ths ranges is use d to measue absorbence of DNAĄ 10 0 - 2oonm 200…

A: Deoxyribonucleic acid(DNA) is one of the most important biochemical compounds for living cells. It…

Q: Correct order ib which the following enzynes would operate to fix a damaged nucleotide in a human…

A: The correct order of enzymes used to fix a damaged nucleotide in a human gene is option d , i.e.,…

Q: (c) Discuss the process of replication of DNA. (d) Derive Michaelis-Menten equation of enzymatic…

A: DNA is present in the nucleus of the cell and it is the genetic information that defines every…

Q: The amount of DNA inintronic regionof genes can be grwater than the amount of DNA in exons. true

A: DNA is the genetic material in humans. It contains all the genetic information that is transferred…