Read very carefully: Chymotrypsin cleaves peptides C TERMINUS to the aromatic amino acids. Trypsin cleaves peptides C TERMINUS to basic amino acids. Cyanogen bromide (CNBR) cleaves C-terminus to methionine residues. With this knowledge, reconstruct the following cleavage products and give the original peptide sequence. CNBR Chymotrypsin WITHHERISALLRIGHT ISTRYWITHM Trypsin EISAM YWITHMEISAMANINGCHEMI STR YWITHHER 1 The which convorted e Name.

Q: Protein structure and function: a) Name two common post-translational modifications of proteins in…

A: Protein is one of three macro nutrients, which are supplements the body needs in bigger amounts. The…

Q: peptide bond formation is catalizyed at the larger ribosomal subunit. does this happend in…

A: Translation includes three phases: initiation, elongation, and termination. Initiation is a phase in…

Q: Show tRNAs with their anticodons bound to met and gly codons first without taking wobble into…

A: The discussion at hand centers on the complex and crucial process of translation that occurs in…

Q: Biochemistry: Site-directed mutagenesis, in which individual amino acid residues are replaced with…

A: Enzyme activity is used to assess the catalytic activity of an enzyme. One enzyme unit (U) is the…

Q: Based on image of protein (enzyme), need to know: a) Number of amino acids and length (Angstroms)…

A: We are given the tertiary structure of a protein (enzyme). Here; the grey spheres indicate carbon…

Q: 1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You…

A: A transfer RNA (tRNA) is a unique type of RNA molecule with the essential function of facilitating…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Describe translation. What is the function of the aminoacyl-tRNA synthase?

A: Protein synthesis: It is a process that involve peptide bond formation between the amino acids by…

Q: Approximately how many nucleotides make up the ATP6 gene? What are the first three nucleotides…

A: Genetic codes are made up of specific nucleotide sequences. Genetic codes are unique for each…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Give typing answer with explanation and conclusion Which of the following statements regarding the…

A: Understanding the structure and function of tRNA is crucial for comprehending the intricate process…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: What is the primary difference betwee class I and class II aminoacyl-tRNA synthetases.   a. Class…

A: An enzyme that synthesizes tRNAs by amino acid polymerization is called an aminoacyl-tRNA synthetase…

Q: Consider the following peptide sequence: Met-Ser-Val-Thr-Ile-Lys-Ala-Cys-Leu-Ser-lle-Tyr-Phe-Ser…

A: Structure of a protein or a peptide is described in four levels: primary, secondary, tertiary and…

Q: Given the following DNA, (A) what is the transcript (mRNA) sequence? (B) What might be the amino…

A: Given: DNA sequence

Q: Provide the DNA sequencce  (not RNA sequence) for the Start Codon and 3 Stop Codons.

A: The method of determining the nucleic acid sequence – the order of nucleotides in DNA – is known as…

Q: Provide the DNA sequence (not RNA sequence) for the Start Codon and 3 Stop Codons.

A: The genetic code is a set of rules that living cells use to convert information found in genetic…

Q: Each type of molecule listed below is recognized by a specific class of nuclear import receptor…

A: Importin and exportin refer to the nuclear transport receptors that are responsible for the…

Q: Using the given information, determine the correct order of the following events during translation:

A:

Q: This is Fos-Jun dimer (1FOS). Is the leucine zipper at the C-terminus or at the N-terminus of the…

A: Fos-jun family proteins are a class of proteins that belong to a large group of DNA binding proteins…

Q: UACTyrosine (Tyr) Fcysteine (Cys) Consider the following DNA coding strand: 5' - ATGTACGGC GAATAA-3'…

A: Within the biological system, the flow of genetic information is explained as molecular biology's…

Q: The ribonucleotides C and G we're mixed together with C two times more abundant than G. The…

A: Introduction: The synthesis of a protein or a polypeptide chain in a living cell is known as…

Q: Reverse translate the sequence of insulin pasted…

A: To reverse translate the given sequence of insulin and optimize the codons for Homo sapiens and…

Q: Describe the function of the Bicoid protein. Explain how its ability to exert its effects in a…

A: The proteins are the biomolecules found in all organisms.