Approximately how many nucleotides make up the ATP6 gene? What are the first three nucleotides listed and which amino acid are they translated to? What is the total number of amino acids in the polypeptide chain that is translated from this DNA sequence?
Approximately how many
ATP6 gene sequence:
ATGAACGAAAATCTATTCACCTCTTTTACTACCCCAACAATAATAGGACTGCCTGTTGTTGTGTTAATCGTTATGTTCCCCAGCATTCTATTTCCCTCGCCTAACCGACTAATTAATAACCGCCTAGTCTCACTCCAACAATGATTAGTACAACTTACATTAAAGCAAATACTGATTACCCACAATTACAAAGGACAAACCTGGGCCCTAATACTTATGTCTCTCATTTTATTTATTGGGTCAACAAATCTGCTAGGTCTACTACCTCACTCATTTACTCCAACTACCCAATTATCAATAAACCTAGGCATAGCCATCCCCTTGTGAGCCGGCACCGTAATCACTGGATTCCGTCACAAAACTAAAGCATCCTTGGCCCACTTTCTACCACAAGGAACACCAGTCCCCTTAATCCCTATGCTCGTAATTATCGAAACTATCAGCCTTTTTATCCAGCCCGTAGCCCTAGCCGTACGACTCACAGCTAATATTACTGCAGGCCATTTATTAATACACCTAATCGGAGGAGCTGCTTTAGCCCTAACAAATATTAGTGCCCCTACTGCTTTAATTACCTTTATCATCCTCATCCTACTGACAATTCTTGAATTCGCTGTAGCTCTAATCCAAGCCTATGTTTTTACCCTACTTGTGAGCCTGTATTTACATGATAATACTTAA
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Molecular Biology of the Cell (Sixth Edition)](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Laboratory Manual For Human Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Inquiry Into Life (16th Edition)](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)