What organism produced this gene sequence? Provide the full genus and species name. Make sure to spell it correctly! (Hint: Use "standard database" and not the "TRNA database" in your search.) >Sequence2c GCGGTTCCACAAGACCCTGAGGCGCCTGGTGCCTGACTCGGACGTCCGGTTCCTCCTCTC

What organism produced this gene sequence? Provide the full genus and species name. Make sure to spell it correctly! (Hint: Use "standard database" and not the "TRNA database" in your search.) >Sequence2c GCGGTTCCACAAGACCCTGAGGCGCCTGGTGCCTGACTCGGACGTCCGGTTCCTCCTCTC

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: What is the corresponding RNA sequence, if the DNA sequence reads TACACCTGG?

A: The RNA or ribonucleic acid is single stranded macromolecule that is composed of nucleotides. RNA is…

Q: What makes it possible to correctly start translation from an mRNA having multiple codons for…

A: Methionine is the amino acid which codes for AUG codon usually.Translation is the process in which…

Q: This BLAST program performs the greatest number of searches for the same query sequence and database…

A: BLAST is used in bioinformatics an an algorithm which compares the sequences of amino acids and of…

Q: che wild type DNA sequence reads THE CAT ATE THE BIG RAT, what type of mutation would change the…

A: Any heritable permanent change in the DNA (deoxyribonucleic acid) sequence is referred to as a…

Q: Based on these sequences, how do you decide decided which fragments were the beginning, middle, and…

A: There are three fragments given in the question. The three fragments can be aligned on the basis of…

Q: Attatched is shown a boxshaded sequence alignment of Horse (top line) and myoglobin (second line).…

A: The introduction provides an overview of the questions related to the significance of the black,…

Q: Find 5’ UTR and 3’UTR of Mrna 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA…

A: All the living cells are made up of protein, which acts as building blocks for every organism. These…

Q: Transcribe the DNA into mRNA. Sequence A…

A: The process of synthesis of messenger RNA with the help of DNA template strand is called…

Q: What exactly is the purpose of the programme Finch TV? Examining the results of sequencing of the…

A: Finch TV is a free software program used for visualizing and analyzing DNA sequencing results,…

Q: Why do geneticists studying eukaryotic organisms often construct cDNA libraries, whereas…

A: A cDNA (complementary deoxyribonucleic acid) library is a combination of cloned cDNA fragments…

Q: The following data shows bisulfite sequencing results for a small region of the genome. How many…

A: The process by which the methyl groups are added to the DNA is called the DNA methylation.…

Q: This descriptor refers to the highest alignment score of all matched sequences to the sequence…

A: The highest alignment score is determined by the BLAST algorithm and is based on the number of…

Q: The variation in the length of tandem repeat of microsatellite DNA has serious translational affects…

A: Microsatellite is a repetitive DNA sequence, in microsatellite some DNA motifs are repeated for so…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: om college and started working at a biotech startup called Scrofa first job assignment is to clone…

A: Prolactin is defined as a hormone by the pituitary gland at the bottom of the brain. Prolactin…

Q: Review concepts 21.5-21.6. Match term and its description. the mechanism contributes to polyploidy |…

A: Chromosomal aberrations are changes in structure or number of chromosomes. These include gain or…

Q: From the following choices, select the DNA sequence that is classified as a mirror repeat. ATCATC O…

A: DNA or deoxyribonucleic acid is the genetic material in living organisms that is composed of…

Q: 4) Consider three different kinds of human libraries: a genomic library, a brain cDNA library, and a…

A: Genomic deoxyribonucleic acid (gDNA) is representative of the chromosomal DNA present in the cells…

Q: Below is the sequence of the yeast S cerevisiae GCN4 gene including 100 bp upstream and 100 bp…

A: Introduction to the topic of introns:Introns are non-coding regions of DNA that are transcribed into…

Q: Match the term with the correct description. satDNA STRs…

A: INTRODUCTION Tandem repeats These are short segments of DNA that can repeat many times within a…

Q: Consider the following four DNA sequences taken from the a homologous gene from four different…

A: Multiple sequence alignment is majorly used to find out evolutionary relationship between…

Q: Use the genetic decoder provided to assist in answering this question.\ Second letter A UUU UUC Phe…

A: Introduction: The process of polymerization of amino acid to form a polypeptide is called…

Q: t the following DNA sequences to RNA sequences. Sequence # 1:…

A: Transcription is a process where the DNA is read and an mRNA transcript is synthesized. This mRNA…

Q: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac…

A: Annotating a genome involves finding functional components throughout its sequence in order to give…

Q: Based on the images attached, what does the similarity in the sequences tell you about the ermB gene…

A: A cladogram is a branching tree diagram that depicts a phylogeny estimation of the evolutionary…

Q: The following are DNA sequences from two homologous genes:…

A: Homology is an idea of finding evolutionary lineage. Homology is deduced when two Deoxyribose…

Q: Identify the type of mutation present in the CDS and discuss the implications on the protein.

A: Mutations are random alteration in the DNA structure which leads to mis-reading of Information on…

Q: please select the gene type is INCORRECTLY matched with its type of genomic sequence. 1. TRNA gene:…

A: The answer is given below,

Q: Below is a set of sequence reads from an individual aligned to a reference sequence. AGACACTCCACC…

A: Homozygous SNPs - has multiple possible alleles - 1 Heterozygous SNPs - has specific insertions or…

Q: Draw the structure of a typical insertion sequence and identify its parts.

A: There are two types of transposons such as replicative and non-replicative transposons. They are…

Q: The following picture shows the ethidium bromide-stained bands obtained by gel electrophoresis of…

A: Electrophoresis is a molecular technique that employs the electrical field to assort biomolecules,…

Q: Based on these sequences. Remove codons 24 to 66, inclusive. Sequence A…

A: The enzyme complex responsible for this excision is known as splicesome. Splicesomes are complicated…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: what is the function and origin of this DNA sequence (use BLAST and NEBcutter)?…

A: Introduction Genes are the main regulatory sequence of nucleotides found in the nucleus which…

Q: You wish to align a 300 bp nucleotide sequence to a genome. Which of the following pairwise sequence…

A: Pairwise sequence alignment is a fundamental process in bioinformatics that includes aligning two…

Q: If a sequence of DNA has 20% Guanine bases how many Adenines would it have? Select one: O a. 10% O…

A: If a sequence of DNA has 20% Guanine bases, then it would have 30% Adenine. Hence, option (c) is…

Q: Based on sequences A,B,C. Provide an anticodon sequence that would build this protein.

A: Codons are the sequences of nucleotides present on the mRNA strand, the tRNA (transfer RNA) brings…

Q: Part 2. Dynamic Programming Assignment, Needleman-Wunsch Algorithm, Affine Gap Cost Align two…

A: Needleman-Wunsch Algorithm is used for global alignment of nucleotide sequences. Here; 'm' is the…

Q: What is the resulting polypeptide: _______________________________________________________? What…

A: Polypeptide It is defined as the polymer of amino acids that are attached together by the peptide…

Q: Please answer asap and type your answer and do not copy from anywhere please NOTE*** double stranded…

A: Restriction enzymes These are also called molecular scissors. These enzymes are extracted from…

Q: Please fill in missing DNA/RNA/Amino Acid sequences.

A: DNA: DNA is the basic unit of life.The information here is stored as a code which is made up of…

Question

What organism produced this gene sequence? Provide the full genus and species name. Make
sure to spell it correctly! (Hint: Use "standard database" and not the "TRNA database" in your search.)
>Sequence2c
GCGGTTCCACAAGACCCTGAGGCGCCTGGTGCCTGACTCGGACGTCCGGTTCCTCCTCTC

Expert Solution

Step 1

Each organism has specific gene sequence associated with it.

Given is a specific gene sequence from some organisms.

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Instructions: Here is some information about the sequences: All these sequences, “SEQUENCE_21” to “SEQUENCE_27” are in the same subfamily or “clade” of a large phylogenetic alignment of all Rab proteins in these three species (see “Figure 1.pdf”,which is the second image, for a full view of gene family in humans, plants and yeast, see the “D” branch towards the bottom of the tree in Figure 1). “SEQUENCE_28” is a different Rab protein (actually it is the Rab39 protein at the bottom of the tree). “SEQUENCE_21” is from yeast. “SEQUENCE_22” to “SEQUENCE_25” are from the plant, Arabidopsis. “SEQUENCE_26” and “SEQUENCE_27” are from humans. Question: Based on the information above, what can you speculate about the possible evolution of the genes that “SEQUENCE_21” to “SEQUENCE_27” represent?
The first thing you'll need to do is annotate the DCR1 gene, as follows: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac cgagacctgg gccggtgagt gcgggtcggg agggaaatgg 121 cctctgccgg gaggagcgag gggaccqсag gс¶¶¶¶gcgc atgacctcag gagccgcgcc 181 gggaggaggg tcgggcgggt ctcagcccct cctcaccccc aggctcccac tccatgtggt 241 atttctacac ctccgtgtcc cggcccqgcc gcggggagcc ccgcttcatc tcagtgggct 301 acgtggacga cacccagttc gtgaggttcg acagcgacgc cgcgagtccg agagaggagc 361 cgcgggcgcc gtggatagag caggaggggc cggagtattg ggaccggaac acacagatct 421 acaaggccca ggcacagact gaccgagaga gcctgcggaa cctgcgcttc tactacaacc 481 agagcgaggc cgttgcqtga ccccqgcccg gggcgcaggt cacgactccc catcccccac 541 gtacqgcccg ggtcgccccg agtctccggg tccgagatcc gcctccctga ggccqcggga promoter: nucleotide 1 - 108; highlight in yellow exon #1: nucleotide 109 - 285; highlight in green intron (there is only one intron in this gene); highlight in light grey exon #2: nucleotide 455 - 567; highlight in blue start…
Your next task is to study Ebola virus (EboV) sequences of different strains. You have received sequences of different Ebola virus strains collected during the Ebola outbreak of 2013 – 2016. EboV from Guinea pig Reference DNA Sample CTA TGC AAG CAG TTA mRNA Protein
What would be the tRNA anticodons for the mRNA in question 3
You are screen sharing Here is part of a gene: 5' TTTAATGGTAACCGTATTGCAGCTATTAGCATAAATG 3' AAATTACCATTGGCATAACGTCGATAATCGTATTTAC 5' 3' If the bottom strand of the DNA is the template strand, what will be the mRNA sequence and the amino acid sequence that are present in the protein? Copyright © 2010 Pearson Education, Inc.
Please help me complete this solution, i cant figure out what is incoorect about this statement... is the Rrna nee to be repleced with Trna?
Below is the CODING sequence of a gene. An A is inserted at position 131. Insert the variant and write the mature mRNA sequence. Then write the amino acid sequence of the resulting transcript. AGAGCTACCAGCTTTAGCGGGATATAAACACACTTATCCTACTATCCCTA 51 TCTTCCCCCAAAGAGGGATCATGCCGTCGACGGCCAAACCGATCGAGCGG 101 AGGTTAAGGGCCATTGGAAAAGGACACTCTGTACGACTAAGAAAATAGC 151 AGCGACTGAGCTGAACGCTACGGGGGGGGGGGTATATACCCCCCCCCCCC 201 CCAGCTACGAGCGACTTTTTATTTTTTTTTTTTATTTTTTTTCTTTTTTA 251 TTTTTTTTGTTTTTTTTTTTCGCGACTACAGAGACTTCTAGCGATCGACG 301 AGCTAGCTAGCGCGGCATCGGACGCGATCGCGATCCTAGACTCTACGAT
You can select multiple answers.
Choose [ Choose] BLAST systems biology proteomics roadmap epigenomics project ENCODE gene annotation proteome
What are the advantages of using larger restriction fragments when constructing a genomic library of human DNA? Please answer asap and type your answer and do not copy from anywhere please
What are the similarities and/or differences between interpreting Multiple Sequence Alignment (MSA) of conserved sequences at the DNA level versus the Amino Acid level? Please site references if possible and have 5+ sentences.