Below is a representation of a pre-mRNA. Numbers represent exons, and letters represent introns: 5’ – 1 A 2 B 3 C 4 D 5 E – 3’ Which is a valid mature mRNA that could be made from it? 1A2BC 235 CDE 1254 ADCE

Below is a representation of a pre-mRNA. Numbers represent exons, and letters represent introns: 5’ – 1 A 2 B 3 C 4 D 5 E – 3’ Which is a valid mature mRNA that could be made from it? 1A2BC 235 CDE 1254 ADCE

Name: Below is a representation of a pre-mRNA. Numbers represent exons, and
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Below is a representation of a pre-mRNA. Numbers represent exons, and letters represent introns:5’ – 1 A 2 B 3 C 4 D 5 E – 3’Which is a valid mature mRNA that could be made from it?1A2BC235CDE1254ADCE

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 7RQ: Portions of eukaryotic mRNA sequence that are removed during RNA processing are . a. exons b. caps...

See similar textbooks

Similar questions

Portions of eukaryotic mRNA sequence that are removed during RNA processing are . a. exons b. caps c. poly-A tails d. introns
Below is an MRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz are numbered as shown. Answer questions 1-4 for the mRNA of Lstqz. A codon table with amino acids shown in single-letter code has been provided at this link. 1 5 10 15 20 25 30 35 40 5' AGAGAUGGCUCCUUCACGCUUUACCUACUGAGUAGGGCUAAG 3’ Which nucleotide number corresponds to the first nucleotide of the stop codon? (Please answer as a numeric value) 30 Write down the first five amino acids generated from this mRNA in single-letter designation with no spaces. Example: if the answer is (from N to C terminus) Histidine-Threonine-Glutamate, you would put in HTE (uppercase) as the answer.
Here is an mRNA sequence (written 5' → 3’) CCAU G U U U U A C c C U A A GUA A GG U A A U AGGU A A C A 3 4 5 6. 7 8 9 10 11 12 13 14 15 16 | 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 Using the genetic code, translate the mRNA. start and stop codons, etc. Write the translation below: don't forget what you know about translation, frames,
A mRNA sequence is shown below. Note that the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA where there are T’s in the DNA. The first triplet of nucleotides AAU (underlined) is in frame for coding, and encodes Asparagine. 45 50 55 60 65 5’—A A C G A A U C G U C G C C A A C U A A G A G –-3’ Which of the following DNA mutations is almost certain to result in a shorter than normal protein? at position 56 a change from G to C an insertion of a G after the G at position 56 inversion of region 56-59 (G C C A) an delete the C at position 52 None of the above.
The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as if you were a ribosome, and write out the translation results. A genetic code table has been provided. mRNA: 5'- A C G U C C A A U G G C A G U G A U U U G A A U C C A -3'
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for proteins in this mRNA?c. what stop codon is present in this mRNA?
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated? The genetic code has been provided for you below. Second letter U C A G UAU UACJ UAA Stop UGA Stop A UAG Stop UGG Trp UCU ) UUU) Phe UUC J UGU U UCC UGC, U UUA LE Ser UCA -Leu UUG, UCG CAU САС His CAA CAG Gln CUU CCU CGU CGC Arg CỤC ССС Leu -Pro CỦA ССА CGA CUG СCG CGG AAC FAS AAGLYS AUU ACU AAU AGU Asn Ser AUC ile AUA AUG Met| ACG AGC AGA Arg AGG J АСС - Thr АСА AAA GAU Asp GACJ Ala GAA GUU GCU GGU U GUC Val GUA GGC Gly GGA GCC GCA GAG Glu GGG GUG GCG First letter Third letter
Here is an mRNA sequence (written 5' → 3') A A IC U JA A G JU A G A G A A C A 2. 3 4 5 6. 7. 8 9 10 11 12 13 14 15 16 17 | 18 |19 20 21 22 23 2425 26 2728 29 30 31 32 133 34 35 don't forget what you know about translation, frames, a) start and stop codons, etc. Write the translation below: Using the genetic code, translate the mRNA. b) c) d) e) Match the event with the # of the type of mutation (in the box below) it will produce (perhaps indirectly). Since there are 4 questions and 3 answers, you’ll obviously have to use something more than once. If you add a nucleotide between #13 and 14. If you change base #6 to a G If you change base #8 to a C If you change base #11 to an A Types of mutation 1. silent 2. missense 3. nonsense Second base U C UUU UCU UAU UGU phenylalanine (phe) UUC tyrosine (tyr) - cysteine (cys) C UAC UAA stop UAG stop UCC UGC UGA stop UGG tryptophan (trp) serine (ser) UUA UCA A leucine (leu) UUG UCG CCU ССС CUU CAU CGU histidine (his) CỤC C CUA CAC CGC C leucine…
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #3) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for a protein in this mRNA?c. what stop codon is present in this mRNA?
Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)
Translation is the process by which the sets of 3 bases (codons) of the mRNA are read to specify the sequence of amino acids for the protein to be produced. Using the genetic code data provided, find the sequence of amino acids that would correspond to the MRNA codons shown. Codons 1 3 MRNA A UGUGGAUC CGAG UCACG Amino acid SECOND LETTER A U UUU Phenylalanine UCU UCC Serine (S) UAU Tyrosine (Y) UAC TAA stop codon UAG stop codon UGU Cysteine (C) UGC TỮA Leucine (L) TGA stop codon UGG Tryptophan (W) F UCA UUG UCG I H CUU CCU CAU Histidine (H) R CGU CỨC Leucine (L) CỦA CCC Proline (P) ССА CCG CGC Arginine (R) CGA CAC "CAA Glutamine CAG (Q CUG CGG G D A AUU L AUC Isoleucine (1) AAU Asparagine AAC (N) ÄÄÄ Lysine (K) AGU Senine (S) ACU ACC Threonine ACA (T) AGC E AUA AGA Arginine (R) E ACG T AUG stat codon (M) AAG AGG TG GƯỮ GAU Apartic acid GAC (D) "GAÄ Glutamic acid GCU GGU GUC Valine (V) GUA GGC Glycine (0) GCC Alanine (A) CE GCA GGA R GUG GCG GGG GAG (E) The start codonencodes the amino…