All the dehydrogenases of glycolysis and the citric acid cycle use NAD+ (E'º for NAD+/NADH is −0.32 V) as electron acceptor except succinate dehydrogenase, which uses covalently-bound FAD (E'° for FAD/FADH₂ in this enzyme is 0.050 V). The E' value for fumarate/succinate is 0.031 V. Calculate the AG'° value for the oxidation of succinate using NAD+. AG'° = Calculate the AG'° value for the oxidation of succinate using covalently-bound FAD. AG'° = +67.55 -3.667 The kJ/mol kJ/mol Based on the E'° values of fumarate/succinate, NAD+/NADH, and the succinate dehydrogenase FAD/FADH2, why is FAD a more appropriate electron acceptor than NAD+ in the dehydrogenation of succinate? positive standard free-energy change favors the oxidation of succinate by covalently-bound FAD. This is consistent with K'eq = 1. Oxidation by NAD+ would require a large, negative standard free-energy change, with K'eq favoring the synthesis of succinate.

All the dehydrogenases of glycolysis and the citric acid cycle use NAD+ (E'º for NAD+/NADH is −0.32 V) as electron acceptor except succinate dehydrogenase, which uses covalently-bound FAD (E'° for FAD/FADH₂ in this enzyme is 0.050 V). The E' value for fumarate/succinate is 0.031 V. Calculate the AG'° value for the oxidation of succinate using NAD+. AG'° = Calculate the AG'° value for the oxidation of succinate using covalently-bound FAD. AG'° = +67.55 -3.667 The kJ/mol kJ/mol Based on the E'° values of fumarate/succinate, NAD+/NADH, and the succinate dehydrogenase FAD/FADH2, why is FAD a more appropriate electron acceptor than NAD+ in the dehydrogenation of succinate? positive standard free-energy change favors the oxidation of succinate by covalently-bound FAD. This is consistent with K'eq = 1. Oxidation by NAD+ would require a large, negative standard free-energy change, with K'eq favoring the synthesis of succinate.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Question 5 Review Figure 21.6 types of DNA sequences in the human genome. The lowest percentage of human genome O repetitive DNA related to transposable elements and related sequences (L1 sequences and Alu elements) O repetitive DNA unrelated to transposable elements (simple sequence and large-segment duplications O unique noncoding DNA O introns O exons O regulatory sequences
Question 43 The DNA strand that serves as a template during transcription is known (other than "template") as the or noncoding strand. Blank 1 Blank 1 Add your answer
QUESTION 28 3.0 All of the following statements about the Illumina (reversible terminator) process for carrying out Next Generation Sequencing (NGS) are true EXCEPT: O A. The template is fragmented into small oligonucleotides with read lengths of 400-500 nucleotides. O B. The template fragments are attached to a glass slide where they are amplified by PCR. OC The different nucleotides (A,C,G,T) that are added during the sequencing reaction are identified by fluorescent labels of different colors. O D. In cases where the same nucleotide multiple times in adjacent positions, the number of nucleotide repeats is determined by the intensity of the fluorescent light flash. O E. The 3' carbon of the labeled nucleotides that are added during the sequencing reaction is blocked.
Question 2
This question has been posted previously with parts A B and C already answered. Please focus on only D, E and F Provided is the question alongside with the added materials next to it. Thank you
Question 20 : The restriction map of the plasmid pSC48 is presented below. The numbers in parentheses correspond to the position of the respective restriction site with respect to position (0). (0) BamHI ЕcoRI (4640) (620) PSC48 5200 pb BamHI (1130) Smal ЕcoRI (3420) (1350) The plasmid has been digested by one or several restriction enzyme(s). The digestion products have been analysed by agarose gel electrophorese. (see figure below). 1 2 10,000 8,000 6,000 5,000 4,000 3,000 2,500 –2,000 - 1,500 -1,000 -750 - 500 -250 1. Digestion products 2. Size marker base pairs Which restrcition enzyme(s) have been used for the digestion? (Indicate the right answer) А- ЕсoRI. B- EcoRI/BamHI. C- EcoRI/Smal. D- BamHI. E- Smal. | |
Question 5 Name 2 differences in the structural features of DNA and RNA and indicate the relevance of each difference to the function/s of DNA and RNA. Number your answers. Use the editor to format your answer
Question 15 of 17 Fill in the blanks: is the wavelength in nanometer used in spectrophotometric estimation of proteins is a catalyst used in Kjeldahl Method is an amino acid responsible for uv absorption of proteins is the word that stands for "I" in ELISA is the active component present in Lowry's Reagent
Question Number-1: Using complementary base pairing method, convert the following DNA sequence into RNA sequence. DNA: TACGGCGCGTATACGACT
Question 2: Part a: Complete the table describing different components of intron removal from mRNA. Nu:, X and Y refer to B-type chemistry shown on the previous page. (YELLOW table shown) Part b: Complete the table describing different components of group I self-splicing intron removal from 26S rRNA in Tetrahymena. (BLUE table shown) Part c: Draw the intron with an all atom structure for Branchpoint A after intron removal from mRNA Part d: Draw the Group I self-splicing intron with an all atom structure for the Guanosine cofactor after intron removal from 26S rRNA in Tetrahymena.
Question 1 Please take the following sequence of DNA and perform 1) DNA Synthesis, 2) Transcription, and 3) Translation in that order. The sequence you get after doing DNA synthesis use for doing Transcription. The sequence you get from transcription use for doing translation. CCATGTTCCTCACCGGGCTATTCAATAAATAAC Answer = 1) ___________________________________________________ 2) ___________________________________________________ 3) ___________________________________________________ asap
Question in photo