A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
A normal mRNA that reads 5’ –
UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has
an insertion mutation that changes the sequence to 5’
-UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’.
Translate the original mRNA and the mutated mRNA,
and explain how insertion mutations can have dramatic
effects on proteins. (Hint: Be sure to find the initiation
site.)
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
