9 The table opposite shows the standard riplet codes for the 20 amino acids involved in protein synthe A section of DNA template strand is shown below (coding strand) DNA 5'-CATCCAAATTGTTGCCCG-3' (a) Write down the sequence of amino acids formed wher section of DNA is transcribed and translated.
Q: 11. Here is a short stretch of replicating DNA. The top strand is the template. Assume the 4.... are…
A: In the multipart question, we are allowed to answer only 1st three subparts. Kindly repost the…
Q: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’…
A: 5' cap help in translation and prevent degradation of m- RNA and poly A tail help on initiation of…
Q: 2. If one strand of a DNA molecule has the base sequence5′-AGCATTAAGCT-3′, what is the base sequence…
A: The deoxyribonucleic acid (DNA) is a hereditary material that is found in almost all living…
Q: uisCUntinuous 4. The sequence of base triplets on the coding strand of part DNA molecule is…
A: tRNA is a RNA molecule that helps in protein synthesis. tRNA forms base pair with complementary…
Q: 6. Return the triplet to its original state (ATG). Now place an additional A after the G, your…
A: Introduction A triplet of bases determines the amino acid, and a variation in the base sequence is a…
Q: 4. You have the following DNA strand. Synthesize a protein from this strand. (Recall that a leader…
A: We all know that Central dogma of life is a unidirectional flow of information from master copy DNA…
Q: 4. In the following figure, mark the position of the start codon, polyA, and the promotor. DNA ORF
A: The DNA sequence codes for the mRNA. DNA sequence consists of all the necessary requirements for the…
Q: 3. The following segment of DNA is the template strand: 5'-.GACATGGAA.-3' a. What is the sequence of…
A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…
Q: 3. One repair mechanism for double-strand breaks involves the unwinding of the damaged DNA followed…
A: DNA repair is the correction of incorrect nucleotides or missing nucleotides in a single strand or…
Q: 4. Is there any situation in which DNA is made based on a RNA template? If there is, explain with an…
A: Note: We will answer the first question since the exact one was not specified. Please submit a new…
Q: ble opposite shows the standard (coding strand) DNA codes for the 20 amino acids involved in protein…
A: Introduction :- Gene expression is the process of formation of response or functional part through a…
Q: 1. Compare and contrast replication and transcription. Replication Transcription Where on the DNA…
A: DNA replication is the process of production of identical copies of DNA molecules with the help of…
Q: 3. Understand Reverse/forwards strands and reverse complementary strand Example sequence…
A: Transcription is the process by which the nucleotide sequence of the DNA (deoxyribonucleic acid) is…
Q: 1. From standpoint of replication and transcription, explain how RNA polymerase is allowed to…
A: Replication is the process of formation of two identical DNA copies from one parent DNA.For this…
Q: 3. In the DNA segment 5'-ATGAGGCATGAGACG-3' (coding strand) 3'-TACTCCGTACTCTGC-5' (template strand)…
A: Deoxyribonucleic acid (DNA) contains 2 segments referred to as coding and template strand. These…
Q: 2. Provide the sequences of the template and coding strands of a DNA double helix that was used to…
A: The RNA or ribonucleic acid is produced from the DNA by the transcription process. RNA is used for…
Q: 5. The pioneering work of Paul Berg, Herbert Boyer, and Stanley Cohen in the early 1970s led to the…
A: Insulin, a peptide hormone produced by the β-cells of the pancreas and is a regulatory hormone for…
Q: 1. Complete the structure of this section of a DNA molecule. Label each base (A.I,G,C), sugar (S)…
A:
Q: 11) Which of the following characteristics is directly related to the coding of a single amino acid…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: 26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C-…
A: Since we only answer one question at a time, we’ll answer question 27 (as you have already solved…
Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in…
A: Mutation: - Random process - Non-directional - Most of the mutations are harmful - Most of the…
Q: 8. Shown below is a DNA strand. 5' GACGTACTACGACTATGGC 3' What is the correct representation of its…
A: Introduction: DNA is a type of nucleic acid present in the nucleus of the cell. It is a genetic…
Q: 25. Which sequence includes RNA that's complementary to the DNA sequence 5'-TATTCGC-3'? (Hint: in…
A: Adenine(A) and guanine(G) are purines ; cytosine(C) and thymine(T)/uracil(U) are pyrimidines , both…
Q: 4. The sequence of base triplets on the coding strand DNA molecule is TGACCGTTAGCG. Which of the…
A: The genetic code is sometimes referred to as a "blueprint" since it provides the instructions that a…
Q: In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where…
A: These grooves arise in DNA molecules because the glycosidic bonds of a base pair are not…
Q: In what organelle of the cell does the process of DNA to mRNA take place?
A: Introduction All organisms are basically made up of cells, through the number, shape and types of…
Q: 2. Describe the process that is occurring in this image protein nibosome
A: The proteins are the final product of a gene that perform all the functions within the cell.…
Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…
A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…
Q: 15. A strand of DNA has the nucleotide sequence shown below. Underneath it, indicate the sequence of…
A: Introduction :- Because of the nature of complementary base pairing, if we know the sequence of one…
Q: 5. During eukaryotic transcription, the molecule that is formed is a. complementary to both strands…
A: the molecule that is formed during eukaryotic transcription is RNA the molecule will be…
Q: 4) Replication of a circular DNA molecule can occur by either theta replication or by rolling circle…
A: Circular DNA - Circular DNA is a kind of DNA that is in the form of loop. Circular DNA has no free…
Q: 1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA…
A: Since you have asked multiple questions, we will answer first question for you. In order to get…
Q: Compare the structure and functions of DNA nad RNA.
A: Nucleic acids DNA RNA DNA : Deoxyribonucleic acid : It is long chain polymer of two…
Q: 6. If you are given the DNA sequence: T-A-C-C-G-A-A-T determine the complementary RNA strand.
A: Introduction :- The term "DNA sequencing" refers to a common laboratory procedure for determining…
Q: What is the main difference in the behavior of DNA and RNA polymerases?
A: Both DNA polymerases and RNA polymerases are enzymes.DNA polymerases are mainly involved during the…
Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…
A: Genes are the fundamental unit of heredity. They store genetic information in the form of DNA, which…
Q: 4.) During DNA replication, the two strands of DNA are pried apart and then serve as templates for…
A: According to our guideline we can answer only the first question. The second question is completely…
Q: 8. The CAS9 enzyme (shown in red in the image below arget and cut out specific DNA sequences.
A: As you have not mentioned which part to answer, we are answering first three for you. If you want…
Q: List the DNA strand sequence complementary to the template strand.…
A: DNA contains Adenine thymine, cytosine, and Guanine. Whereas in RNA the Thymine is replaced by…
Q: 4. Given the following problems in bacterial DNA replication, identify the defective enzyme or…
A: In bacterial DNA replication is mainly carried out by DNA polymerase that synthesize the new strand…
Q: 25. Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.…
A: Transcription is a process in which the genetic information in the DNA is converted into RNA in the…
Q: 3. Replicate the following segment of DNA. 5'-ATCGGCTACGTTCAC-3' 3'- TAGCCGATGCAAGTG-5'; and show…
A: Answer: Introduction: The semi-conservative replication means in which two copies of original DNA…
Q: Why is that DNA polymerase and RNA polymerase can synthesize polynucleotides only from 5' to 3' to…
A: DNA polymerase is the enzyme required for replication of DNA and RNA polymerase is the enzyme…
Q: A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a…
A: Answer is option 1 Explained in paper pen format in step 2
Q: 5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…
A: The base pairing rule of DNA is purine always pairs up with pyrimidine. Adenine(A) and Guanine(G)…
Q: Regarding the triple DNA code, which of the following statements is true?
A: The genetic code refers to the set of rules that all living organisms use to encode information,…
Q: 3) Analysis of the sequence of a DNA fragment shows the presence of restriction site for the enzyme…
A: The restriction site is the site which is a type of specific genetic sequence present on the DNA…
Q: 4.) what is the amino acid chain that your answer in item 2 will dictate? Question in Item 2: The…
A: Given, Question in Item 2: The complementary strand from item 1 undergoes transcription. What will…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the parent DNA (3' to 5') strand correspond to a start codon and its last three nucleotides correspond to a stop codon in its MRNA counterpart later on.) Write it down as follows: a. the sequence of parent DNA (template) 3' A C A TT 5' 3' Upon undergoing DNA replication, show what one daughter DNA molecule will look like. Write it down as follows: b. the sequence of DNA Daughter 1: 3' 5' 5' 3' C. the sequence of DNA Daughter 2: 3' 3' 5' in in1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the mRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the MRNA sequence be? Explain your answer and label all strands. 歐歐队 相阳阳一即即的 9 First letter…1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the MRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the mRNA sequence be? Explain your answer and label all strands. A. First letter of codon…
- . The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be denatured into single-stranded DNA molecules. Becausethe base composition of the two strands differs, thestrands can be separated on the basis of their densityinto two strands designated W(atson) and C(rick). When each of the purified preparations of the single strands was mixed with mRNA from cells infectedwith the virus, hybrids were formed between the RNAand DNA. Closer analysis of these hybridizationsshowed that RNAs that hybridized with the W preparation were different from RNAs that hybridized withthe C preparation. What does this tell you about thetranscription templates for the different classes ofRNAs?5’-GGC TAC GTA ACT TGA TAA-3’ (a) mRNA codons that are transcribed from the DNA (b) tRNA anticodons for each of the mRNA codons (c) The sequence of amino acids in the resulting polypeptide. (d) Provide the sequence of another possible DNA strand that will lead to synthesis ofthe same polypeptide.Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?
- Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3' 3' CACGATCGCCCTTACTCGACCCTATGATCATCCCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 - 5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your mRNA into an amino acid sequence. Begin at the first codon. Third First position (5' end) Second position position (3'end) UGU Cys UAU Tyr Cc UGC Cys UGA Stop UGG Trp UCU Ser -Y UAC Tyr UAA Stop UAG Stop UUU Phe - F UUC Phe UUA Leu UUG Leu FL UCC Ser -- UCA Ser UCG Ser CGU Arg CGC Arg ER CGA Arg CGG Arg CCU Pro CAU His CUU Leu CUC Leu -- CAC His CAA Gln CAG Gln CCC Pro -P A - CUA Leu CUG Leu CCA Pro CCG Pro AAU Asn AAC Asn AGU Ser AGC Ser AGA Arg ACU Thr AUU lle AUC lle AUA lle AUG Met M ACC Thr -T ACA Thr ACG Thr A. AAA Lys K AAG Lys -R AGG Arg A. GAU Asp -D GAC Asp GGU Gly GGC Gly GCU Ala GUU Val GUC Val GCC Ala A -G GGA Gly GGG Gly A -V GUA Val GUG Val GCA Ala GCG Ala GAA Glu -E…a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
- Telomerase supplies its own template RNA molecule as shown in Figure 3 below: B AAUCCCAAU TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the ends (5' and 3') on the DNA and RNA strand at position X, Y and Z, in the Figure 3. (ii) Draw and explain the two loop structures at the end of telomere.(i) (.:, From the diagram to the right of the trp repressor in its approximate binding relationship to a double-stranded DNA mole- cule, what is the relative orientation of the macrodipoles of helices 4 and 5 to each other? Indicate the N-terminal ends of helices 4 and DNA 5 5? Which residue in the sequence above is the N-terminal residue of each helix? N N (ii) :. Comparing the two protein sequences above, identify all amino acid pairs that differ in electrostatic charge due to proton dis- sociable groups (assume pH 7). Indicate the charge of both residues for each pair. C.Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?