8.) Answer the following questions regarding the following DNA sequence. 3'TACGGGGATAGCCGGCGAATTAAATAGCTGTC - 5 A.) What is the MRNA sequence that would result from transcription of this sequence? Assume that the DNA would be read from left to right. B.) What is the amino acid sequence that would result from translation of the MRNA resulting from the sequence? See Codon Table on next page. C.) What is the anti-codon found on the tRNA that would deliver the amino acid for the first codon in the MRNA sequence? 20

Q: put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2.…

A: The translation is the process by which cells make proteins. Here, the mRNA formed by transcription…

Q: Yeast have 8 similar tRNA genes with the anticodon 5’-GUA. A researcher mutates one of these genes…

A: Tranafer RNA helps in transporting amino acid as per the instructions given by messenger RNA during…

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: Using a table that shows which codon represents which amino acid determine the following:   A)…

A: The three nucleotide sequence either DNA or RNA is called codons.During protein synthesis, it codes…

Q: 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation…

A: DNA(deoxyribonucleic acid) is the genetic material in all the organisms except few viruses. The…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…

Q: The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA…

A: DNA replication is the process of formation of copies of DNA. It takes place in nucleus of cell.…

Q: How does the aminoacyl-tRNA synthetase that attaches the amino acid proline know which tRNA to…

A: tRNA is a small, well-characterized RNA molecule which plays a key role in protein biosynthesis.…

Q: a) Two of the following three mRNA sequences code for the same protein.  Delete the sequence which…

A: Translation is defined as the process where the nucleotide sequence in the mRNA is translated to…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: After sequencing a segment of DNA you identify the following sequence: 5…

A: Answer: DNA sequence : It is the genetic sequence or the order of nucleic acids in DNA.  DNA…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: 2. In the cytoplasm of the cell below, four tRNA molecules are carrying amino acids. a) What amino…

A: Translation is a 2 step process where nucleotide sequence transcribed from DNA present inside…

Q: The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition…

A: E.coli is a type of bacteria that normally lives in the intestine. It is also found in the gut of…

Q: Transcribe the following DNA sequence into codons.…

A: Transcription is a process in which there is formation of messenger RNA from the DNA template In…

Q: Each type of molecule listed below is recognized by a specific class of nuclear import receptor…

A: Importin and exportin refer to the nuclear transport receptors that are responsible for the…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: 2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find…

A: The translation is the process of polymerization of amino acids to form polypeptides or protein. It…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: Which of the following recognizes the mRNA codon 5' - U A A - 3'?

A: Firstly, information is transferred from the DNA to mRNA by the process known as transcription. Then…

Q: Give the anticodon of the tRNA that would be a "wobble match" for the codon 5'AGG3'.

A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…

Q: You are studying a eukaryotic gene in which translation normally begins at the second AUG in the…

A: Self-explanatoryPlease give me a helpful rating if you are satisfied with my answer

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.