Answered: 6. If 16% of the bases found in an…

Name: 6. If 16% of the bases found in an organism's DNA aremade up of adeni
Uploaded: 2022-11-30T17:34:22.000Z
Channel: Bartleby
Description: 6. If 16% of the bases found in an organism's DNA aremade up of adenine, what percentage of cytosine willbe found in that DNA (assume the organism's DNA isdouble stranded)?

Science

Biochemistry

6. If 16% of the bases found in an organism's DNA are made up of adenine, what percentage of cytosine will be found in that DNA (assume the organism's DNA is double stranded)?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 7RQ: DNA double helix does not have which of the following? antiparallel configuration complementary base...

See similar textbooks

Related questions

Q: 9. In the DNA double helix, why are purine bases on one DNA strand never paired with other purine…

A: DNA DNA is a hereditary molecule found in the nucleus of eukaryotic cells. They contain genes which…

Q: DNA and RNA have very similar primary structures, yet their secondary and tertiary structures are…

A: DNA and RNA are polynucleotide chains. DNA stands for Deoxyribose Nucleic Acid while RNA stands for…

Q: 5. You imagine that not all life forms (including viruses and aliens) must have double stranded DNA…

A: a.The genome is double stranded RNA. Since, there is no thymine (T) in the genome and there is…

Q: Using Chargaff's rule of base pairing determine the amount of guanine in 120 bp long fragment of…

A: According to Chargaff's rule amount of adenine is equal to amount of Thymine. Similarly amount of…

Q: 8. If you only had the amino acid sequence of the protein, would you be able to figure out the exact…

A: Translation Through the process of translation, mRNA sequences is translated into the sequence of…

Q: 18. The free energy contribution of base pairing (AG released) is negative and single- stranded RNA…

A: G-C pair form three hydrogen bonds with each other. DNA with high G-C content is more stable.

Q: 2. For each DNA sample, draw a linear stretch of DNA about 15 nucleotides long, with a nucleotide…

Q: 9. After the process of DNA replication, there are two newly formed strands of DNA in each double…

A: DNA replication is the process by which a cell duplicates its DNA before cell division. The process…

Q: translate the following sequence of messenger RNA nucleotides in a sequence of amino acids forming…

A: Since you have posted a question with multi-sub parts, we will solve the first three sub-parts for…

Q: 3. Hydrogen bonds are quite weak compared to covalent bonds. Explain why this fact is actually…

A: ANSWER: Hydrogen bonds, despite being weaker than covalent connections, are sufficient to keep the…

Q: 3. Why can DNA adopt both A- and B- forms, while RNA is restricted to the A-form?

A: DNA is two strands of polynucleotide linked to each other in an antiparallel direction by hydrogen…

Q: 1. On paper, write out the first 30 bases in the middle of the page in order. You want ensure you…

A: Disclaimer: "According to the guidelines of bartleby, only one question is to be answered. Please…

Q: Each nucleotide pair of a DNA double helix weighs about 1 × 10–21 g. The human body contains…

A: DNA is a polynucleotide and each strand of DNA is made up of certain numbers of nucleotide, this is…

Q: . the position that distinguishes between DNA and RNA is 2. the carbon that the phosphate group…

A: 1. The position that distinguishes between DNA and RNA is A sugar called ribose is found in RNA,…

Q: In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where…

A: These grooves arise in DNA molecules because the glycosidic bonds of a base pair are not…

Q: 6. James Watson and Francis Crick were the two scientists who received credit for identifying the…

A: James Watson and Francis Crick are credited with identifying the structure of DNA in 1953. They used…

Q: DNA is made up of Group of answer choices guanine, thymine, deoxyribomucleic acids Guanine,…

A: Deoxyribonucleic acid (DNA) is a molecule that contains the biological directions that make every…

Q: The mole fraction composition of one of the strands of a double-helical DNA molecule is [A] = 0.30…

A: DNA's structure and replication mechanism were discovered thanks to Erwin Chargaff's research. It…

Q: 8. DNA can form triplexes, where a third strand of the right sequence fits into the major groove.…

A: When pyrimidine or purine bases form Hoogsteen pairs with purines from Watson-Crick basepairs in the…

Q: 5. Name the five nitrogenous bases in the table below, and put an X in the correct column for each…

A: A nitrogen base, sugar molecule, and phosphate groups make a nucleotide. A nucleotide is a…

Q: 16. Compare and contrast DNA and RNA. Try to include a few concepts/terms in each column. DNA Both…

A: DNA Both RNA DNA is made up of deoxyribonucleotides. DNA and RNA has sugar-phosphate backbone.…

Q: 5. Some bacteria (extremophiles) live near hydrothermal vents in the ocean, where they thrive at…

A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…

Q: 2. The following DNA sequence corresponds to the complete coding sequence of a gene three-amino acid…

A: To obtain the anticodon sequences, we need to convert the complementary DNA sequence to RNA by…

Q: 1

A: INTRODUCTION:- A mutation is any change in the nucleotide sequence of DNA.Some mutations affect…

Q: 2.Fill in the blank with the best answer. If band 3 (6 kB) in lane 5 contains 280 ng of DNA, then…

A: Fill in the blank the question. Average weight of one DNA base pairs= 650 Dalton. 1 Dalton =…

Q: C A T A C G C G T A с G

A: The given figure shows the process of DNA replication. DNA replication refers to the process of…

Q: 7. Which of the following phosphates in a single-stranded DNA molecule is covalently attached to a…

A: DNA - DNA is Deoxyribonucleic Acid. It is a type of nucleic acid. It is composed of two…

Q: The process of attaching biological functions to DNA sequences is called?

A: DNA is present inside the nucleus.

Concept explainers

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.

Question

Practice Pack

OFFON

6. If 16% of the bases found in an organism's DNA are
made up of adenine, what percentage of cytosine will
be found in that DNA (assume the organism's DNA is
double stranded)?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

Includes step-by-step video

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Learn your way

Includes step-by-step video

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

4. If your nucleotide sequence is - Is this sequence DNA or RNA? Explain how you know. What would the sequence of the complementary strand be? 5'- ATGTCCTAGAG - 3'
13. a. Draw in the corresponding DNA nucleotide that would base pair with the adenine nucleotide shown below using the same level of detail as provided in the image below. Hint: Remember that DNA bases pair in the antiparallel orientation. орасна you A OH H b. How do you know the adenine nucleotide drawn above is from DNA and not RNA?
4. Which of the following single-stranded DNA molecules would be palindromic in the double-stranded state? (A-T-G-C-C-G-T-A, G-T-C-A-T-G-A-C, A-T-G-C-T-A-C-G, G-C-T-A-T-G-A-C)
10.) Draw a double-stranded DNA molecule (using different colors for each) model should clearly represent the sequence: A G T A C C G G G C A A Note: It should include items to represent - sugar molecules - phosphate molecules - 4 distinct nitrogenous base molecules (Adenine, Thymine, Cytosine, and Guanine) - two types of bonds between these molecules
3. For this short DNA segment, a. identify the 5' end and the 3' end of the molecule. b. circle the atoms that comprise the backbone of the nucleic acid chain. c. write the nucleotide sequence of this DNA segment. P-OCH, CH, HN OP-OCH, NH, OCH, OH 4. A DNA strand has the sequence ATGGCAATCCTCAAACGCTGT a. What is the sequence of the complementary DNA strand? b. What is the sequence of the mRNA that would be produced during transcription from the original strand of DNA? 5. Write the codon on mRNA that would pair with each tRNA anticodon. a. UUG b. GAA c. UCC d. CAC
8. DNA can form triplexes, where a third strand of the right sequence fits into the major groove. Draw the H-bonding you would expect to see if a thymine H-bonded with an A-T base pair in the major groove. What kind of base would H-bond with a G-C base pair and where?
22..2 if one strand of the DNA molecule has the sequence 5’ TACGA 3, The other strand would have the sequence: 3’ UACGCA5’ 3’AUGCGU 5’ 3’ ATGCGT 5’ 3 TACGCA 5’ 3’ ATGCGT 5’
8. Which of the following diagrams best illustrates a DNA molecule? R R CH2 O H,N-C-C-N-C-C -N-C-C CH2 O H CH, O H H3C CH3 H H. H нн CH3 Peptide Bonds- HO, GC HC3» NH )=P-O– CH2 O. H Nitrogenous base Phosphate (thymine) group ОН Sugar
4. The base content of a particular DNA molecule is 24% G. What is the percentage of the following bases in the molecule? %A: 5. What is the structural difference between the pentose sugars in DNA and RNA? % T: % C: 6. Why is the AT base pair less stable than the GC base pair?
3. Imagine that the double-stranded DNA molecule shown was broken at the sites indicated by spaces in the sequence, and that before the breaks were repaired, the 11 base pair DNA fragment between the breaks was reversed (inverted). What would be the base sequence of the repaired molecule? Explain your reasoning. 5' TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGTGCGTACÁC 3' 3' ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCACGCATGTG 5'
5. DNA is made of two strands that are antiparallel. If one strand runs from 3' to 5' direction the other one will go from 5' to 3' direction. During replication or transcription, whatever the process is, it will always follow the 5' to 3' direction using the 3' to 5' directed strand as the template strand. Therefore, if following is the DNA sequence 5'-CCG ATC GCA CAA-3' a) Using this sequence as template after transcription no protein can be translated. Why? I. Presence of start codon II. Absence of start codon III. Due to mutation b) If you want to start the translation, what change you need in the second codon (from 5' to 3' direction)? I. Substitution of C with G II. No change III. Deletion of C IV. Both I & III
1. Given is a strand of DNA, fill in the corresponding RNA strand and find which amino acids that strand codes for.