4. The bars in the following sequence indicate the breakpoints of a deletion. 5'-CGGGTATCTACTAAA|TTCGCACTTACGAGGATTAACATCCGATTG|TACCGAATGAGAATC-3' Which primer pair would you use to genotype for this deletion, such that all genotypes will result in a band? a. 5'-CGGGTATCTACTAAA-3' and 5'-TACCGAATGAGAATC-3' b. 5'-CGGGTATCTACTAAA-3' and 5'-GATTCTCATTCGGTA-3' с. 5'-CGGGTAТСТАСТААА-З" and 5'-CCТCGTAAGTGCGAA-3' d. 5'-CGGGTATCTACTAAA-3' and 5'-CATCCGATTGTACCG-3' e. There is no way to design a pair of primers that provide positive evidence

4. The bars in the following sequence indicate the breakpoints of a deletion. 5'-CGGGTATCTACTAAA|TTCGCACTTACGAGGATTAACATCCGATTG|TACCGAATGAGAATC-3' Which primer pair would you use to genotype for this deletion, such that all genotypes will result in a band? a. 5'-CGGGTATCTACTAAA-3' and 5'-TACCGAATGAGAATC-3' b. 5'-CGGGTATCTACTAAA-3' and 5'-GATTCTCATTCGGTA-3' с. 5'-CGGGTAТСТАСТААА-З" and 5'-CCТCGTAAGTGCGAA-3' d. 5'-CGGGTATCTACTAAA-3' and 5'-CATCCGATTGTACCG-3' e. There is no way to design a pair of primers that provide positive evidence

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

what does the Depletion of essential gene products causes spontaneous DNA damage major result mean in this experiment? (interpretation)
1) Using the diagram below, sketch in the pattern of bands you would expect to see after digesting the DNA of the TT, Tt and tt genotypes of the TAS2R38 gene. Use the Base Pair Standards on the left of the diagram as a reference in drawing the positions of the bands. Base Pair TASTER GENO TYPE Standards (Base Pairs) TT Tt tt 500 400 300 200 100 50
11). This pedigree illustrates a family in which some members have a completely penetrant disease caused by a dominant mutation. This mutation is linked at a distance of 10 map units from a SNP marker with three different alleles (1, 2 and 3). The SNP alleles found in each family member are indicated below each pedigree symbol. It is not yet evident whether the very young individuals labeled A and B will develop the disease. a. What is the probability that individual A will develop the disease? b. What is the probability that individual B will develop the disease? 1,3 2,2 1,2 3,2 O 1,2 3,2 A B
7:12 What is not true for Sequence tagged site (STS) markers: O cannot be mapped by fluorescence in situ hybridization (FISH) O subset of STS markers are known as expressed sequence tag (EST) markers O can readily be screened by a PCR assay O short DNA sequences that occur at a unique location in the genome
The genomes of two E. coli strains are compared in Figure14-19. Would you expect any third strain to contain moreof the blue, tan, or red regions shown in Figure 14-19?Explain.
please complete part C
A pair of paralogous repeats, A and B, have 96% sequence similarity and therefore can promote non-allelic homologous recombination (NAHR). They exist in four possible arrangements in a genome, illustrated below as arrangements 1 – 4. What is the result of NAHR between repeats A and B in arrangement 1? A.Translocation between chromosomes 1 and 2 resulting in monocentric chromosomes B.Deletion or duplication of the region between A and B C.Translocation between chromosomes 1 and 2 resulting in acentric and dicentric chromosomes D.Inversion of the region between A and B