The answer I have currently selected is not correct.? Observe the sequencing data comparing a wild type and a Tay-Sachs individual.Normal HEXA alleleTay-Sachs alleleinsertionframeshiftsubstitutionnonsenseArg - lleCGT ATAIdentify the changes that describe the Tay-Sachs mutation.inversiondeletionSerTyrGly - ProTCC TAT GCC CCTAsp.GAC...CGT ATA TCT ATC CTA TGC CCCTGAс

Name: The answer I have currently selected is not correct.? Observe the sequ
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: The answer I have currently selected is not correct.? Observe the sequencing data comparing a wild type and a Tay-Sachs individual.Normal HEXA alleleTay-Sachs alleleinsertionframeshiftsubstitutionnonsenseArg - lleCGT ATAIdentify the changes that desc

A uncommon genetic illness called Tay-Sachs disease damages the neurological system gradually. It is…

Science

Biology

Observe the sequencing data comparing a wild type and a Tay-Sachs individual. Normal HEXA allele Tay-Sachs allele Arglle nonsense inversion deletion *** CGT Ser Tyr-Gly Pro-Asp- ATA TCC TAT GCC CCT GAC *** CGT ATA TCT ATC CTA TGC ccc Identify the changes that describe the Tay-Sachs mutation. insertion frameshift substitution TGA C...

Observe the sequencing data comparing a wild type and a Tay-Sachs individual. Normal HEXA allele Tay-Sachs allele Arglle nonsense inversion deletion * CGT Ser Tyr-Gly Pro-Asp- ATA TCC TAT GCC CCT GAC * CGT ATA TCT ATC CTA TGC ccc Identify the changes that describe the Tay-Sachs mutation. insertion frameshift substitution TGA C...

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter6: Cytogenetics: Karyotypes And Chromosome Aberrations

Section: Chapter Questions

Problem 17QP

See similar textbooks

Similar questions

Achondroplasia is an autosomal dominant form of dwarfism caused by a single gene mutation. Calculate the mutation rate of this gene given the following data: 10 achondroplastic births to unaffected parents in 245,000 births.
Mouse models for human genetic diseases are potentially powerful tools to help geneticists understand thecause of the aberrant phenotypes and develop newtherapeutic measures. However, such mice are not always as useful to investigators as it might seem at firstglance. Suppose that you have a mouse knockoutmodel for a human disease caused by homozygosityfor a null allele of a gene. Discuss how the followingsituations might complicate investigations of the human disease based on this mouse model.a. Mice have a shorter life span than humans.b. Mice homozygous for certain knockout mutationsdie in utero.c. Mouse genomes may have additional copies of thegene whose mutation causes the disease in humans.d. Mice from different inbred lines homozygous forthe same gene knockout vary in the penetrance andexpressivity of the phenotype.e. Manipulations to create the knockout mouse, suchas the presence of a drug resistance gene that allowsthe selection of cells containing the knockout (seeFig. 18.9),…
Mouse models for human genetic diseases are potentially powerful tools to help geneticists understand thecause of the aberrant phenotypes and develop newtherapeutic measures. However, such mice are not always as useful to investigators as it might seem at firstglance. Suppose that you have a mouse knockoutmodel for a human disease caused by homozygosityfor a null allele of a gene. Discuss how the followingsituations might complicate investigations of the human disease based on this mouse model.a. Mice have a shorter life span than humans.b. Mice homozygous for certain knockout mutationsdie in utero.c. Mouse genomes may have additional copies of thegene whose mutation causes the disease in humans.
The amino acid sequence of part of a protein has beendetermined:N . . . Gly Ala Pro Arg Lys . . . CA mutation has been induced in the gene encodingthis protein using the mutagen proflavin. The resultingutant protein can be purified and its amino acidsequence determined. The amino acid sequence of themutant protein is exactly the same as the amino acidsequence of the wild-type protein from the N terminus of the protein to the glycine in the preceding sequence. Starting with this glycine, the sequence ofamino acids is changed to the following:N . . . Gly His Gln Gly Lys . . . CUsing the amino acid sequences, one can determinethe sequence of 14 nucleotides from the wild-typegene encoding this protein. What is this sequence?
Best II TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Primer design worksheet T7 Promoter Bsp 1061 Cial ...KS primer binding site Kpn 1 Eco01091 Dra II CACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGGTCGAC.. 17 primer binding site Not I Hind II EcoRV EcoRI Pst l Smal BamHI Spel Xbal | Eagl BstX | Sac II T ...GGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTC... SK primer binding site Primer Xhol Identify all possible Reverse primers and write out their sequence KS primer binding site... The diagram above shows a portion of the pSK+ multicloning site. For this worksheet, you need to design primers that could be used to amplify a gene cloned into the EcoRI cloning site. There are 4 primer sites indicated on the diagram. The primers need to be designed to bind to each of the primer binding sites indicated on the diagram. Fill in the following information: Identify all possible Forward primers and write out their sequence: Primer 5'-3' sequence…
What phenotypes do you think a homozygous tra1hsn animal with a loss of function Egl-1 mutation would have.
Trinucleotide repeat expansions (TNREs) are associated with severaldifferent human inherited diseases. Certain types of TNREsproduce a long stretch of the amino acid glutamine within theencoded protein. When a TNRE exerts its detrimental effect byproducing a glutamine stretch, are the following statements true orfalse?A. The TNRE is within the coding sequence of the gene.B. The TNRE prevents RNA polymerase from transcribing thegene properly.C. The trinucleotide sequence is CAG.D. The trinucleotide sequence is CCG.
Original DNA Sequence: TACAC CTTGG CGACGACT... MRNA Sequence: Amino Acid Sequence: Mutated DNA Sequence #5 TACACCTT G G GACGACT... (Highlight the change) What's the mRNA sequence? What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? 1. Which type of mutation is responsible for new variations of a trait? 2. Which type of mutation does not result in an abnormal amino acid sequence? 3. Which type of mutation stops the translation of an mRNA molecule? NO
Associated SNPs outside of gene no effect on protein production or function. T G Associated SNPs within gene no effect on protein production or function Regulatory sequences A Coding region с T Noncoding SNP: changes amount of protein produced www.Biolnteractive.org Causative SNPs within gene Unassociated SNP far from gene on same chromosome or different chromosome Protein Coding SNP: changes amino acid sequence b. Which types of SNPs might be identified in a GWAS? 4. Consider the different types of SNPs shown in Figure 3: associated, unassociated, and causative (including both noncoding and coding). a. Which types of SNPs affect protein production or function for the gene of interest? Figure 3. A diagram showing various ways in which a SNP could be associated with a certain gene and its trait. GWAS in the News Read the following news release, which describes a GWAS study with dogs. Note that a dog's coat refers to its fur or hair. Variants in Three Genes Account for Most Dog Coat…
Fill up the blank __________s are blood diseases caused by mutationsthat eliminate or reduce the production of globinpolypeptides from one of the clusters but not the other.These mutations can include deletions of specific genesor the LCR in either cluster.
Researchers in search of loci in the human genome that arelikely to contribute to the constellation of factors leading tohypertension have compared candidate loci in humans and rats[Stoll, M., et al. (2000). New Target Regions for Human Hypertensionvia Comparative Genomics. Genome Res. 10:473–482].Through this research, they identified 26 chromosomal regionsthat they consider likely to contain hypertension genes. Howcan comparative genomics aid in the identification of genesresponsible for such a complex human disease? The researchersstate that comparisons of rat and human candidate loci tothose in the mouse may help validate their studies. Why mightthis be so?
Homozygosity for extremely rare mutations in a humangene called SCN9A cause complete insensitivity topain (congenital pain insensitivity or CPA) and a totallack of the sense of smell (anosmia). The SCN9A geneencodes a sodium channel protein required for transmission of electrical signals from particular nerves inthe body to the brain. The failure to feel pain is a dangerous condition as people cannot sense injuries.The SCN9A gene has 26 exons and encodes a1977-amino acid polypeptide. Consanguineous matings in three different families have resulted in individuals with CPA/anosmia. In Family 1, a G-to-Atransition in exon 15 results in a truncated protein that is898 amino acids long; in Family 2, deletion of a singlebase results in a 766-amino acid polypeptide; and inFamily 3, a C-to-G transversion in exon 10 yields a458-amino acid protein.a. Hypothesize as to how each of the three SCN9Amutations affects gene structure: Why are truncatedproteins made in each case? b. How would you…