3a. George is a marathon runner. Describe the changes in the proportion of energy supplied by different energy systems and the fuel used while running. 3b. George is going to run a half-marathon race next week. He will carry a bottle of drink with him during the race. Give him a suggestion on the selection of drinks and give the reasons for your choice.

Q: Question 3 What are the diseases associated with hypocomplementaemia and which complement deficiency…

A: A great number of diseases are caused due to multiple problems. And hypocomplementemia is such…

Q: Describe the steps of transcription in bacteria

A: Introduction - In the nucleus, transcription occurs. To make an RNA (mRNA) molecule, it uses DNA as…

Q: How the presence of Pseudomonas aeruginosa in lungs aggravate the condition of patient having Cystic…

A: The airways of patients with cystic fibrosis (CF) are exceptionally complicated, concerned with…

Q: 3' Shown is a segment of DNA about to be replicated. a) What is the sequence of the complementary…

A: The leading strand always form on the strand that is 3'-5' in direction.

Q: The acquisition of memories can be demonstrated in rodents on a T-maze task. In this task, a food…

A: Homeostasis is extremely important for organism existence. It is frequently seen as a resistance to…

Q: using,   3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: You implant a sample material subcutaneously in the back of a rabbit model in an effort to evaluate…

A: Injury, blood material interactions, provisional matrix construction, acute and chronic…

Q: Question 4 In order to replicate both strands of DNA SIMULTANEOUSLY , E. coli bacteria folds or…

A: The replication process is responsible for producing the ds daughter DNA molecule from parental ds…

Q: Q4 - What are two features of your protein's (Phosphoenolpyruvate carboxykinase, PCK1) structure…

A: Answer-4 A protein is a normally occurring, extremely complex substance that consists of amino acid…

Q: The lack of a cure or effective treatment for malaria can be attributed to. The expected return on…

A: Answer :-(D) The lack of cure or effective treatment for malaria can be attributed to malaria is no…

Q: Ultraviolet light principally causes which of the following dmages to DNA? A methylation of specific…

A: UV light can kill cells by damaging DNA to an irreversible extent. The light initiates reaction…

Q: born with sickle cell anemia. What is the frequency of individuals in this population who do not…

A:

Q: Directions: Read and understand the situation very carefully. Hanabi, a grade 12 student have…

A: The examination of the evolutionary development and connections among or even within groups of…

Q: The acquisition of memories can be demonstrated in rodents on a T-maze task. In this task, a food…

A: The task described the homeostasis and growth factor of mice . The innate and adaptive behaviour…

Q: Debra weighs 154 lbs and completes a maximal GXT. It was determined she has a maximal MET capacity…

A: MET: described as the ratio of the metabolic charge (power consumed) in the course of…

Q: The subunit in E. coli RNA polymerase which is required for recognition of the promoter sequence is…

A: Transcription is a process by which an RNA copy of the DNA is made. It is an important step in gene…

Q: Question 33 RNA polymerase II: A is located in the nucleoplasm and transcribes the protein-encoding…

A: Transcription is the process which is required for formation of mRNA from template strand of DNA.

Q: . What is Ringworm? What are the different types of ringworm?

A: Ringworm is A highly contagious fungal infection of the skin or scalp. Ringworm is spread by…

Q: Similar genes in two separate lineages that are the result of a "lineage splitting event" A at some…

A: Species is defined as the group of individuals that can mate together.

Q: What is a recombinant DNA vaccine? List two such vaccines. State their advantages.

A: Plasmids, which are small circular pieces of DNA, are used in the production of recombinant DNA…

Q: Question 5 Which of the following distinguishes a DNA from an RNA? O Presence of a GC base pair in…

A: Uracil helps in many synthesis by acting as a allosteric regulator and co enzyme in many synthetic…

Q: Cuvier's idea of catastrophe related to asteroid collisions understanding that geological change…

A: Theory of catastrophes by George's Cuvier According to this theory, fossil show that animal and…

Q: In a certain African population, 4% of the population is born with sickle cell anemia (aa).…

A: p2 + 2pq + q2 = 1 and p + q = 1 p = frequency of the dominant allele in the population q = frequency…

Q: Spongy bones do not have a haversian system. a) False b) True

A: Introduction - Compact bone is more dense and lighter than spongy (cancellous) bone. Plates…

Q: Question 14 Which of the following is NOT true regarding E. coli replication on the lagging strand?…

A: In case of E. Coli replication of lagging strand: The synthesis is discontinuous and occurs 5' to 3'…

Q: The eukaryotic transcription factor that exhibits a sequence specificity for the TATA box is: A)…

A: Transcription is the first step in the gene expression which transfers the genetic information…

Q: Match the force for evolution with its description, definition or example. This force typically…

A: Introduction Evolution is the process of a species' features changing over numerous generations…

Q: Tabular form, briefly discuss the functions and locations of the Spinal Nerves and come up a…

A: Spinal nerves are very important as they carry sensory information from the peripheral parts of the…

Q: A wealthy elderly couple die together in an accident. Soon, a man shows up to claim their fortune,…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: A team of researchers investigated the effects of phosphorous availability and light intensity on an…

A: Plants produce food through the physicochemical process of photosynthesis, which is a…

Q: state why simplicity and speed are top priorities in selecting DNA isolation method

A: * Deoxyribonucleic acid that is isolation is the extraction process of DNA from other sources. * The…

Q: Can two normal individuals of the same species with sexual reproduction have identical genomes and…

A: Introduction - Sexual reproduction is a type of reproduction that comprises a complicated life cycle…

Q: 7. RSV is a and as generated during times of biotic and m. abiotic stress in plants. 8. RSV produced…

A: Solution :- Stage 1 Here I examine about RSV and their job in plants as indicated by fill in the…

Q: short eared mutant male rabbit was crossed with normal long eared doe rabbits and 29 long eared and…

A: This is a type of monohybrid cross because only one character is involved. Dominant character can…

Q: 27. Based on your knowledge of the structure and organization of prokaryotic and eukaryotic gen…

A: Prokaryotes are primitive cells which have simple cellular organisation. They do not have any…

Q: Which option would not disturb a Hardy-Weinberg Equilibrium in a population? a) Random mating b)…

A: Hardy-Weinberg Equilibrium is the theory of population which states that the genetic variation in a…

Q: Organisms growing anaerobically cannot perform glycolysis for long without reducing the pyruvate…

A:

Q: Which of the following enzymes is responsible for the bulk of DNA synthesis during replication in…

A: DNA pol I,II and III are present in prokaryotes. However it is the DNA polymerase III which is…

Q: Q.3. What do you think is more dangerous - Active smoking or passive smoking? State why.

A: Introduction In this question we will discuss about the Active smoking and passive smoking.

Q: Why is Raphanobrassica fertile, whereas its progenitorwasn’t?

A: Raphanobrassica. Any intergeneric hybrid between Brassica (cabbages, etc.) and Raphanus is known as…

Q: What is genetic drift?

A: Introduction In this question we will discuss about the genetic drift.

Q: Question 8 Why is replication called semi-conservative? A not all leading strands are conserved B…

A: During DNA duplication, is the method to copy DNA stands when new cells are formed.

Q: We are not usually consciously aware of our blood glucose levels because: O Information about blood…

A: Brain senses the changes in the blood glucose levels but the information is processed by the PNS and…

Q: What are the primary and the secondary constrictions of a chromosome? What is the other name given…

A: Chromosome At the time of cell division the chromatin material get condensed to form chromosomes…

Q: Rain falls on a fertilized agricultural field after a farmer has harvested the crop. Which…

A: Macronutrients of plants include Carbon, Nitrogen, Phosphorous along with the role of water. In…

Q: Q.2. State the behavioural changes observed in an alcohol addict and remedial measures to overcome…

A: The following modifications have been observed:   Because alcoholic beverages are expensive, they…

Q: Which molecules regulate cross-bridge attachment activity? O a. tropomyosin and M lines O b. calcium…

A: The Muscular System is a vital physiological system that humans require in order to exist. This…

Q: iscuss the intestinal phase of gastric secretion regulation with examples

A: The digestive system is involved in a variety of processes, including food digestion and nutrient…

Q: Which of the following is not part of the green revolution? -Irrigation -Mechanization -GMO's…

A: Green Revolution (a term utilized for rapid expansions in wheat and rice yields in emerging nations…

Q: Having the ability to degrade the DNA allows the DNA polymerase to perform its job properly and…

A: Answer :- True. - It is true that having the ability to degrade the DNA allows the DNA polymerase to…