33.Choose the DNA nucleotide sequence that would be complementary to the following strand (note: pay attention to DIRECTION of replication): 5' GTAGTCA 3' 3' UATUAGA 5' b 5' TGACTAC 3' 3' ACGACTG 5' 5' UGACUAC 3'. 5.Using agarose gel electrophoresis to analyze DNA, short DNA travels the long DNA. a faster than slower than C at the same speed as d. Question 6 Which type of bonds link the individual nucleotides together in DNA? a Glycosidic bond Peptide bond Phosphodiester bond Electrostatic bond Hydrogen bond b. e Question 7 A typical engineered plasmid vector often contains the following features except a A poly linker region b. Origin of replication A signal peptide An antibiotic resistant gene a. C. d.

33.Choose the DNA nucleotide sequence that would be complementary to the following strand (note: pay attention to DIRECTION of replication): 5' GTAGTCA 3' 3' UATUAGA 5' b 5' TGACTAC 3' 3' ACGACTG 5' 5' UGACUAC 3'. 5.Using agarose gel electrophoresis to analyze DNA, short DNA travels the long DNA. a faster than slower than C at the same speed as d. Question 6 Which type of bonds link the individual nucleotides together in DNA? a Glycosidic bond Peptide bond Phosphodiester bond Electrostatic bond Hydrogen bond b. e Question 7 A typical engineered plasmid vector often contains the following features except a A poly linker region b. Origin of replication A signal peptide An antibiotic resistant gene a. C. d.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

4. Below is a replication fork. This is half of a replication bubble. 3' 3' a. Draw a circle to indicate the location of the helicase and an arrow to show the direction it is moving. e. b. On each DNA template, draw just one RNA primer (short, thick line) and the new DNA (longer). Label 5' and put an arrow head on 3' ends. c. The top strand would be the circle one: (leading strand / lagging strand) d. RNA primase and helicase are both what type of biomolecules (polymers) is the catalyst that adds new nucleotides of DNA.
6. Please help answer this question and show all work, thank you so much.
If primase makes an error and incorporates an incorrect base in the nucleic acid primer, then why would this not be a problem given the DNA replication mechanism? O Primase only copies end sequences that will be protected by telomers The lagging strand utilizes a helicase to prevent replication errors O Primase can be error proofed using a domain of DNA polymerase O The RNA primer sequence is removed and not used as a template
typical lab bacterial species that grows at 37°C. Explain your reasoning. 13. One strand of DNA reads as follows: 5'-ATG GCG CGA CTG ACT-3' A. How many nucleotides are listed here? B. What are the three structural components of one nucleotide? C. Write the appropriate sequence for the complementary strand above or below the sequence shown. Be sure to include which end of the complementary strand is 5' and which end is 3'.
1. Answer the following A. What is the relationship between the DNA molecular weight and the distance travelled by DNA fragments from the well? Create a line diagram with DNA molecular weight as the X axis and distance travelled as the Y axis. B. How is the DNA charge and molecular weight considered in agarose gel electrophoresis?
6.You have used the primer 5' CTGA 3' in a DNA sequencing reaction with the template DNA sequence shown below. DNTPS, DNA polymerase and ddTTP were also added. Write out the sequence of 4 DNA fragments you expect to produce in your sequencing reaction. Include the 5' and 3' ends of each fragment in your answer. 3' AAGACTCGATCGATCGTTTCCTCA 5'
Match to their function from list.
#3 under Identify the Structures is what? A. phosphate polymerase complex B. DNA polymerase complex C. deoxyribose sugar polymerase complex D. nitrogen base polymerase complex
Give detailed Solution with explanation (don't give Handwritten answer
answer above is wrong, need help identifying which one is right. Thanks!
Can you please answer???
5. DNA is made of two strands that are antiparallel. If one strand runs from 3' to 5' direction the other one will go from 5' to 3' direction. During replication or transcription, whatever the process is, it will always follow the 5' to 3' direction using the 3' to 5' directed strand as the template strand. Therefore, if following is the DNA sequence 5'-CCG ATC GCA CAA-3' a) Using this sequence as template after transcription no protein can be translated. Why? I. Presence of start codon II. Absence of start codon III. Due to mutation b) If you want to start the translation, what change you need in the second codon (from 5' to 3' direction)? I. Substitution of C with G II. No change III. Deletion of C IV. Both I & III