3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation.
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’
5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’
Make vertical lines between codons to make this assignment easier to do.
Which strand is the template strand?
The first strand is the template strand as it going 3-5
Copy the template strand in mRNA. Label the 5’ and 3’ ends.
5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3”
Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins.
Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val
- What do you notice about the mRNA strand compared to the non template strand of DNA?
2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this?
3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation.

Trending now
This is a popular solution!
Step by step
Solved in 3 steps









