新 22 e codon is 5' 5'-GAA-3'. O 3'-GAA-5'. 3'-CTT-5'. O 3'-CUU-5' O 5-CUU-3

Q: d) RNA Seq is used to determine off-target effects of Cas9 cleavage. Why is this an appropriate tool…

A: The ground-breaking gene-editing tool CRISPR-Cas9 has quickly established itself as an essential…

Q: 4 of e flag Transcribe the following DNA: TACGGGGCTGAGATT Select one: a. UACGGGGCUGAGAUU O b.…

A: Transcription is the process by which genetic information encoded in DNA is used to synthesize RNA…

Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…

A: Introduction :- The process of protein synthesis occurs in two steps which are transcription and…

Q: 2. Complete the leading strand and the complementary strand vith the 5'and 3' ends and identify he…

A: DNA replication is the process by which a new DNA molecule is formed and this process is known as…

Q: please answer remainnig questions too thanks. 1) Missense mutation 1)Deletion in Exon2, causing…

A: Mutations arise when a DNA gene is damaged or altered in such a manner that the genetic message…

Q: The second MRNA molecute is the acias they code Ior. same as the original mRNA except it has an…

A: Mutation It is defined as the alteration in the sequence of DNA due to the exposure to some mutagens…

Q: The arrow in the diagram below indicates the direction of movement of the replication fork. 5' A B C…

A: During DNA replication, the two strands of the DNA double helix are separated and each strand serves…

Q: O 3'-GTA-CAG-CCG-CGT-5' ) 5'-CAC-GUC-GGC-GCA-3' 3'-CAT-GTC-GGC-GCA-5"

A: His-Val-Gly-Ala His= CAC Val=GUC Gly=GGC Ala=GCA   these amino acids get coded by other codes too,…

Q: 23. Design the forward, reverse, and internal primers to the gene below and mutate the…

A: Primers are stretches of nucleic acids (either DNA or RNA) that help in DNA replication. DNA…

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: an opening reading frame is defines by _ 1 absence of highly repetitive sequence 2homology with…

A: To locate the gene sequence inspection are used because the gene has distinctive features which…

Q: If you had the RNA sequence below: 5' UUUGGAG3 and you were going to make a piece of DNA that would…

A: Uracil is the unique base in RNA, whereas in DNA it is thymine..  The strands runs antiparallel; one…

Q: Find start codon and stop codon

A: The start codon marks the site at which translation into protein sequence begins, and the stop codon…

Q: If a point substitution mutation changes the sequence 5'ATGAAA3' to 5'ACGAAA3' in the MIDDLE of the…

A: Point mutation is a genetic mutation in which a single nucleotide base is altered, inserted or…

Q: 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the mRNA…

A: The coding strand of DNA is the one that contains the instructions for the gene in concern. The…

Q: A. The insertion shifts the reading frame to the right .The deletion frameshifts the reading frame…

A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…

Q: What would be the sequence that the RNA polymerase synthese from the follwing DNA sequence? 5'…

A: Transcription: The process of formation of RNA from the DNA by  action of DNA dependant RNA…

Q: of a gene are (is) used as the template for RNA synthesis. a sense strand antisense strand both…

A: The process of synthesis of a Daughter stand from the parental DNA strand is called replication.…

Q: The X's correspond to the missing information. You need to determine what those X's represent DNA…

A: DNA, RNA, and protein are the three principal molecules that store and transmit genetic information…

Q: AGTGCATTTCCAGGGA Above is a randomly generated sequence of DNA 16 bp long. Determine the Tm of this…

A: The Temperature of Melting (Tm) is defined as the temperature at which 50% of double stranded DNA is…

Q: 5' AUGAGGAUGGCCAGUCAAUUUGA 3' 5' AUGGAUGGCCAGUGCAUUUGA 1. Missense 3' 2. Silent 5'…

A: Frameshift deletion occurs when one or more than one nucleotide in a nucleic acid is removed,…

Q: Using this strand of DNA (TACAACTGA), show what a deletion and insertion would look like”

A: Nucleotides are subunits of DNA, and each nucleotide is made of a sugar molecule called deoxyribose,…

Q: 6.c. Mutated DNA Template Strand #3: 3'-TACTGAC TGACTATC-5' Complementary DNA sequence: mRNA…

A: The mutation is the change in the base sequence of the DNA nucleotide sequence or a gene. The…

Q: How long is the polypeptide produced from the following mRNA transcript?…

A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…

Q: missense,

A: 1. Non- conservative missense mutation occur , when G was substituted with C .

Q: Below are two sequences of a segment of DNA. Normal sequence TAG GTC CÁC Mutated sequence TAG GTC…

A: TRANSVERSION In this mutation involving a transversion i.e. a purine is substituted for a pyrimidine…

Q: TRANSCRIPTION Unzipped Single Strand of DNA Messenger RNA

A: Deoxyribonucleic acid (DNA) is the genetic material that contains the instructions for the growth,…

Q: Adds nucleotides in in the 5' to 3' direction during transcription. [Select ] [ Select ] ligase…

A: RNA polymerase

Q: Answer the ff. DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' A. is the 3rd amino…

A: Transcription: The process of making mRNA from DNA is called Transcription. mRNA strand Synthesised…

Q: DNA Polymerase Holoenzyme Il is represented below. It consists of several domains with distinct…

A: At the replication fork, DNA polymerase III holoenzyme (Pol III HE) works with the helicase and…

Q: The sequence of the transcript is 5'-GGUUACAUUC-3'. The sequence of the DNA template would be:…

A: Transcription is a biological process that occurs in the cells of living organisms, where genetic…

Q: Transcribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5'…

A: Translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…

Q: The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction.…

A: In 1977, Frederick Sanger and his colleagues developed a method for sequencing DNA, which was later…

Q: 13- Which statement is not correct for primer design criteria? a) In the length of 18-22 nt b)…

A: A primer is a sequence of short, single-stranded DNA used in the technique of polymerase chain…

Q: The anticodon sequence created from the following DNA: TACGGGGCTGAGATT Select one: O a.…

A: The sequence of nucleotides that complement codons is known as an anticodon. They are found in tRNAs…

Q: Telomerase Nucleoside RNA Polymerase I RNA Polymerase II RNA Polymerase IIIon E of qu sven UOY…

A: As per the bartleby guidelines we are suppose to answer only first 3 questions for fill in the…

Q: 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription…

A: Introduction :  One of the earliest steps in gene expression is transcription. The transfer of…

Q: termini). What type of mutation is each? 6.a. Mutated DNA Template Strand #1: 3'-TACTGTC TGACGAT…

A: DNA It is a double helix structure that constitutes two polynucleotide chains wound around each…

Q: Any RNA polymerase in any organism: OA Synthesizes RNA chains in the 3' to-5 direction O B. Binds…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: A. The insertion shifts the reading frame to the right. The deletion frame shifts the reading frame…

A: A mutation is any change in the sequence of DNA or nucleotides in genetic material. It is caused by…

Q: Provide the sequences of the template and coding strands of a DNA double helix that was used to…

A: Introduction :- The template strand is a strand of DNA that serves as the blueprint for the…

Q: Consider prokaryotes, choose the CORRECT enzyme/keyword for the following function/role: Adds…

A: Asked : Correct enzyme for the given statement

Q: r it 6- Complete the following: a) Two fragments of DNA can be joined by a b) Restriction enzymes…

A: Recombinant DNA technology is the process by which we can isolate our gene of interest and then…

Q: 5'   ATTTACGTTTT  3' 3'  TAAATGCAAAA  5'    Need help drawing a diagram showing the replication…

A: DNA =Deoxyribose Nucleic Acid It is so named because there is no oxygen in the 2' end of ribose…

Q: Which of the following DNA mutations is almost certain to result in a shorter than normal protein?

A: In the present circumstance, we possess a DNA sequence and its equivalent mRNA sequence. It is…

Q: 47 If base #6 is changed from A to T, what type of mutation is this?? ANTISENSE STRAND 5' ATTTGACGG…

A: Antisense strand is also known as template strand. This strand is used to produce mRNA during…

Q: Which primer would bind to this coding strand as a reverse primer? 5' - ATGGCCAAAT GATTCCCACG…

A: Primers are very short sequences of nucleotides (usually 18 to 22 nucleotides) that play an…

Q: The following drawing represents simultaneous transcription and translation in E. coli. Answer the…

A: We all know that central dogma is a very basic procedure to produce proteins.But there are several…