Q: 18. In the following figure, structure C represents a , while structure F represents a Asparagine D…
A: The figure shows the process of translation.Translation is the process in which ribosomes in the…
Q: 2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged…
A: Mitochondrial tRNA in humans has gained interest due to the discovery of associations between point…
Q: 23. Once a polypeptide chain has begun growing during protein synthesis, an incoming RNA carrying…
A: When protein synthesis has been started, each new amino corrosive is added to the lengthening chain…
Q: The peptidyltransferase reaction begins with the hydrolysis or breaking of the bond between the…
A: The translation is the process in which the genetic code carried by mRNA is decoded to produce the…
Q: Met-enkephalin (Tyr–Gly–Gly–Phe–Met) is a painkiller and sedative (Section 21.5). What is a possible…
A: Metenkefalin could be an artificial kind of the naturally occurring, endogenous opioid amide,…
Q: 1c. Write in the specific ANTICODON and the specific AMINO ACID in the boxe This image on the right…
A: tRNA is called as transfer RNA and helps in transfer of information from the mRNA to protein (…
Q: Taking start and stop codon into consideration, if we have an mRNA sequence with 30 nucleotides, how…
A: Peptides are peptide bonds that connect short chains of amino acids. Dipeptides, tripeptides, and…
Q: 1. Assume that the ribosome has just catalyzed the formation of a peptide bond, but the ribosome has…
A: Translation of the nucleotide bases sequence in the mRNA to the amino acids results in the formation…
Q: give the codon sequences of every code on this tRNA with the anti-codon 5AAG3, could pair with…
A: tRNA are transfer RNA which are responsible for decoding the information on mRNA for the synthesis…
Q: elelgmst AMO 3. The following mRNA strand is being used to assemble a polypeptide strand by a noit…
A: Given: An mRNA strand is given and we need to find A. Respective amino acid sequence. B. Alternative…
Q: 18. The free energy contribution of base pairing (AG released) is negative and single- stranded RNA…
A: G-C pair form three hydrogen bonds with each other. DNA with high G-C content is more stable.
Q: Given this MRNA strand: 3 - AUGAGGAAGGUA - 5"; what are the components of the polypeptide?
A: The polypeptide is formed by decoding the triplet codons using the codon table given. The mRNA…
Q: 16) PROTEIN SYNTHESIS: A) Describe the process of protein synthesis. Be sure to use transcription…
A: Proteins are polymers of amino acids formed via peptide bond between two amino acids .
Q: Given this mRNA strand: 3’ - AUGAGGAAGGUA - 5’; what are the components of the polypeptide?
A: Translation is the process in which the genetic message carried by mRNA from the DNA is converted in…
Q: 13. The codon for the amino acid methionine (met) is AUG. What is the corresponding anticodon found…
A: Amino acids are the building blocks of proteins where the combination of 20 different proteins helps…
Q: 1- Please write any MRNA sequence that produces protein sequences of 'INFRMATICS'. By using your…
A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer…
Q: 4. a. A polypeptide contains 36 amino acids. How many nucleotides should be found in the open…
A: Codons are triplets of nucleotides, which codes for specific amino acids. The open reading frame is…
Q: 3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched…
A: Transfer RNA or tRNA is defined as a molecule which helps to decode mRNA or messenger RNA into a…
Q: 8. A peptide hormone consists of nine amino acids in this sequence: arg-pro-pro-gly-phe-…
A: In this question, we are given a peptide sequence which is arg-pro-pro-gly-phe-ser-pro-phe-arg. We…
Q: 7. Draw a tRNA that would recognize the codon 5' A U G 3'. What is the sequence of this tRNA's…
A: As per the guidelines we are supposed to answer only the first question in case of multiple question…
Q: 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach…
A: Hemoglobin is a conjugated protein with four polypeptide chains. It contains two identical alpha and…
Q: 9) In another mutation from the original wild-type sequence, the bolded G in the middle of the…
A: The DNA is transformed into proteins through the process of transcription and translation. The…
Q: 1. Given the anticodon in tRNA is CUU, name the amino acid that will be added. 2. Given the…
A: Since it is a multipart question we are supposed to answer only the first three questions as per the…
Q: bust me int Tly di gerlarat bu nd ambigu 22. Some tRNAS contain inosine, which can base pair with A.…
A: A transfer RNA or tRNA:It is a special type of RNA molecule. It helps in matching of an amino acid…
Q: 26. Once a polypeptide chain has begun growing during protein synthesis, an incoming RNA carrying…
A: Ribosomes synthesize proteins. Proteins are formed from amino acids. 70S ribosomal complex is…
Q: 21. Which of the following mutations would be expected to have the most harmful effect on the…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: This is Fos-Jun dimer (1FOS). Is the leucine zipper at the C-terminus or at the N-terminus of the…
A: Fos-jun family proteins are a class of proteins that belong to a large group of DNA binding proteins…
Q: 11. Why is RNA polymerase a good name for this enzyme? Explain each part of the name: RNA, polymer…
A: Replication is the process which makes DNA from the parental strand of DNA. Transcription is…
Q: 29. Translation ends when O a release factor causes the translation complex to dissociate TRNA…
A: Translation is the process of formation of a polypeptide chain from an mRNA transcript. It occurs…
Q: 21. mRNA serves as template for the synthesis of polypeptide. true or false
A: The translation process is by which organisms forms protein or a polypeptide chain.
Q: 22. Some tRNAs contain inosine, which can base pair with A, C, and U. Why might this be advantageous…
A: The interaction between the molecular surfaces occurs due to various reasons. The reasons…
Q: C9. The peptide “backbone" consists of repetitive "“units" of amino group nitrogen-alpha…
A: Proteins are biopolymers made of amino acid units. Amino acids are comprised of carbon, hydrogen, a…
Q: Given the going with molecule of DNA: strand 1 – A T G C G C T A C G C A T–strand 2 – T A C G C G A…
A: In living organisms, the genetic instructions for growth, development, functioning, and reproduction…
Q: ive the sequence of every codon this tRNA, with the anticodon 5'AGG3
A: Genetic code is very important to understand the codon –anticodon phenomena. As known that the…
Q: 12. Using the provided "Genetic Code-Reference" answer the following question. Based on the…
A: mRNA codon sequence-: 5'-GGU-ACG-CUA-3' Aminoacids sequence: Gly-Thr-Leu
Q: Put the following events in the synthesis of a polypeptide in the proper order. An initiator tRNA…
A: Ribosomes are the made of RNA and proteins. During translation m RNA is processed in the ribosome…
Q: 1. In what direction does a polymerase move when synthesizing a strand of mRNA? Briefly Explain. 2.…
A:
Q: 32.) Translate the following mRNA into protein primary structure. Use the ONE-LETTER abbreviations…
A: Note: You have asked multiple independent questions and thus we have solved the first question for…
Q: 37. A portion of an mRNA attached to a ribosome reads: 5′ UUUGACCCCACG 3′ If a tRNA with an…
A: answer The tRna with which amino acid attached will enter A site will be CCC codon which codes for…
Q: 17. How would you computationally predict the thermodynamic stability of a long, extended RNA helix?…
A: Thermodynamic stability is the state when the structure is in a conformation that has the lowest…
Q: 5' ACTGAGGATTCGGACAGCAATAGGATG 3' When translated, the -1 reading frame of the sequence above gives…
A: The mRNA codon chart is used to find the amino acid with respect to the particular codon.
Q: 22. Which of the following mutations would be expected to have the most harmful effect on the…
A: Mutations Mutations are defined as any change or alteration in the base sequences of the DNA further…
Q: 4. How many codons are in the longest ORF? 5. What is the frame of the shortest ORF? 6. How many AA…
A: ORF is a stretch of DNA sequence that begins with translation initiation site (start codon) and ends…
Q: 2. Of the hundreds of confirmed tRNA genes in the human genome, only one has the sequence 5' ATT 3'…
A: The anti-codon present recognizes the codons present on the mRNA in the cognate tRNA. The…
Q: 1d) What amino acid would a tRNA with the anticodon 5'AGG³' carry?
A: The amino acids are the fundamental structural unit of proteins. There are 20 amino acids that code…
Q: 3b) In the real world, where "wobble" pairing is possible, what is the minimum number of tRNAs…
A: The process of formation of mRNA(messenger ribonucleic acid) molecules on the DNA(deoxyribonucleic…
Q: 24. During the disassembly of a nucleosome which part of the nucleosomes is the first to be removed.…
A: The capacity of nucleic acids to guide their own reproduction from monomers makes them unique.…
Q: 11. A mutant bacterial cell has a defective aminoacyl synthase that attaches a lysine to tRNAs with…
A: Proteins are polymer of amino acids which perform specific functions in the cell, mutations happen…
5’-AUGCCGGACUGAAAU-3’
What is the sequence of the resulting protein assuming the ribosome takes the first AUG as triplet codon ?
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about the genetic code, what would be the shortest possible codon length? Explain.Discuss Concepts A mutation occurs that alters an anticodon in a tRNA from 3-AAU-5 to 3-AUU-5. What effect will this mutation have on protein synthesis?5’-GGC TAC GTA ACT TGA TAA-3’ (a) mRNA codons that are transcribed from the DNA (b) tRNA anticodons for each of the mRNA codons (c) The sequence of amino acids in the resulting polypeptide. (d) Provide the sequence of another possible DNA strand that will lead to synthesis ofthe same polypeptide.
- 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene15-2. Explain whether the following statements are true or false.Justify the false ones.A. Ribosomes are the cytoplasmic structures that duringProtein synthesis is linked by an mRNA moleculeforming polyribosomes.B. The Leu-His-Arg-Leu-Asp-Ala-Gln-Ser- Amino Acid SequenceLys-Leu-Ser-Ser is a signal sequence that directs proteinsinto the endoplasmic reticulum.C. All transport vesicles in the cell must have av-SNARE protein in its membrane.D. The transport vesicles carry protein and lipid to thecell surface.E. If the delivery or distribution of lysosomal proteinsprospects from the trans-Glogii network to endosomes areblock, lysosomal proteins would be secreted by pathwaysof constitutive secretion like those in Figure 15-28.F. Lysosomes digest only substances that have been takenby cells by endocytosis. 15.3 Many of the proteins produced in the reticulumendoplasmic changes such as the addition ofcarbohydrates (oligosaccharides). What is the function of thesesugars in such proteins? 15.4…5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG
- Pissssssssss helppppppppp, One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein synthesis of a eukaryotic cell using the nitrogen bases of the given DNA strand. Include the following terms in your description (1 paragraph pls): -DNA - mRNA -protein -tRNA -Amino acid -codon -nucleus -Ribosome -cytoplasm -transcription -translation5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3′ What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU U UUC UUA UUG CUU C CUC CUA CUG U Leu GUA GUG CCU Leu CCC CCA CCG AUU ACU A AUC ACC AUA ACA AUG Met ACG lle UCC Ser UCA UCG GUU GCU G GUC Val GCC с GCA GCG Second Letter Pro Thr Ala A | Tyr UAU UAC UAA Stop UAG Stop CAU His CAC CAA Gin CAG AAU Asn AAC AAA AAG GAU GAC GAA GAG UGU Cys U UGC UGA Stop A UGG Trp G AGU AGC AGA Lys AGG | Asp Glu CGU CGC Arg CGA CGG Arg UCAG ULAG SCAG GGU GGC Gly GGA GGG с Ser U letter 3rd G12:18 A Bell Ringer for We.. / Bell Ringer for Wednesday Draw a line between the codons for each strand of MRNA: 1. AGGUCAUGCAUGGGCAUGCAU 2. AGAGAUUCAGCUAGCACGAUA 3. GUCAUCGAUCGAUCGGAUGCC 4. UUUCAGUCAGCUAGCGAUCGU 5. CUAAUGUGGAUCCUGAACGCU Use the codon chart to translate the amino acid sequence for the given MRNA strand. Below each codon, write the 3-letter abbreviation for the corresponding amino acid. A G A G U UU GAGA UCUGGUUGGAA AG CGUA uUA A c GUAU A G G A U C G A U G G G GU G clu UA G cUA G A II
- 5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the template (an T) was mutated to a A. (A) Now, what is the mRNA sequence? (B) What is the amino acid sequence of the translated protein? (C) Would this protein be able to carry out its function?Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13
![Biology: The Unity and Diversity of Life (MindTap…](https://www.bartleby.com/isbn_cover_images/9781337408332/9781337408332_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Biology: The Dynamic Science (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781938168130/9781938168130_smallCoverImage.gif)
![Biology: The Unity and Diversity of Life (MindTap…](https://www.bartleby.com/isbn_cover_images/9781337408332/9781337408332_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Biology: The Dynamic Science (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781938168130/9781938168130_smallCoverImage.gif)