Name:Date:2. The sequence of a fragment of one strand of DNA isAATTGCATATACGGGAAATACGACCGG.Transcribe thiss sequence into MRNA. er bns eldst eboo oiebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onimeJlaw as ye s 1ot noitematelomet AHG3. The following MRNA ştrand is being used to asemble a polyp

DNA (deoxyribonucleic acid) is the hereditary unit of an organism. DNA is a double helical structure…

Answered: 2. The sequence of a fragment of one…

2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this sequence into MRNA. eri bns eldet ebo .

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 14SQ: Energy that drives translation is provided mainly by ___ . a. ATP b. amino acids c. CTP d. all of...

See similar textbooks

Related questions

Q: Examine the following coding strand DNA nucleotide sequence,representing the complete gene sequence…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…

Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…

A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…

Q: 26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C-…

A: Since we only answer one question at a time, we’ll answer question 27 (as you have already solved…

Q: kle cell hemoglobin DNA ÇACGTAGA CTGAGG ACA ckle cell hemoglobin MRNA ckle cell hemoglobin AA…

A: Sickle cell anaemia is a inherent condition in which red blood cells are abnormally fickle shaped…

Q: a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1…

A: Transcription is a process in which a DNA strand is transcribed into mRNA by an RNA polymerase…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: . What mRNA base sequence would be obtained from the following portion of a gene?

A: Genetic information is transferred from genes to the proteins via messenger RNA.…

Q: 8. You have a piece of DNA with the sequence shown below.…

A: EcoRI is one of the most commonly found restriction endonuclease and it is isolated from the E.…

Q: 1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the…

Question

Name:
Date:
2. The sequence of a fragment of one strand of DNA is
AATTGCATATACGGGAAATACGACCGG.
Transcribe this
s sequence into MRNA. er bns eldst eboo oi
ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime
Jlaw as ye s 1ot noitem
atelomet AHG
3. The following MRNA ştrand is being used to asemble a polyp

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Energy that drives translation is provided mainly by ___ . a. ATP b. amino acids c. CTP d. all of the above
ebitgeqyloq erl to noihoq ertt qu 9lem bluow iert ebios onime et enimalsb nworle llew as yes TOi noitemoini ebulonl elelgmst AMO 3. The following MRNA strand is being used to assemble a polypeptide strand by a ribosome: 5'-AUGCUUGCUCAUCGGGGUUUUAA-3' AHR (a) Write out the amino acids that will be assembled, in their correct order. (b) Provide an alternative MRNA sequence with four or more changes that would translate to the same amino acid sequence.
of estion 9 t of uestion THCA ▶ Sou 100- HC This reaction is Entropy is THC San Leafly ATA RNA polymerase SSSSSSSSSS ATTOGOGACATAA ATGACGGATCAGCCOCAAG UACUOCCUAGUC RNA Transcript TACTOCCTAGTCGGCOTTCOOCTTAACCOCTOTATIT (In this picture, RNA is being made by complementary base pairing with DNA.) This reaction is → Entropy is ◆
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
Complete the complementary strand: mRNA transcription ATTCGAGGCTAA
5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.
Number 7
26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C- A- A- G- T- A- C- T- T- G- T- T- T- C- T- T- A- A- A 5' A LIGUULAUGAOLAAAGAAUUL Phe- MRNA: Amino Acids: met Phe- met Asme -LyS- G la- 27. Suppose the two guanosine (G) nucleotides in3 above were changed to two cytosine (C) nucleotides. What is the new amino acid chain? 28. Suppose the two guanosine (G) nucleotides in #3 were removed from the DNA strand. How would this mutation affect the amino acid chain? Write out the new amino acid chain.
What is the lagging strand sequence if the leading strand of DNA is TTA CCG ATC GAA? How many amino acids can be identified if the coded mRNA sequence is GCAUUACAUGGCGGA
Label the 5’ and 3’ untranslated regions and the start and stop codons on your mRNA.
3. Using your Genetic Code, translate and group the following mRNA bases. Example: UAC CAG UGG UUU CUA AUC Your Answer: AUG GUC ACC AAA GAU UAG Met – Val - Thr- Lys – Asp - Stop 5' CUCGGUACGUAAUAGAUCUAUCAUCC GAGACUCUUAAAU 3 b. 5' CUAAUAUUGUGAGAU 3'
Give the mRNA and amino acid sequence from this DNA strand: CCATTAACCTTACTGCTGGCTAAATTCGTTGCT