2. One repair mechanism for double-strand breaks involves the unwinding of the damaged DNA followed by the invasion of a template that contains identical or highly similar sequences as the damaged DNA. What is the name of this mechanism? Nucleotide excision repair Nonhomologous end joining Homologous recombination Mismatch repair

2. One repair mechanism for double-strand breaks involves the unwinding of the damaged DNA followed by the invasion of a template that contains identical or highly similar sequences as the damaged DNA. What is the name of this mechanism? Nucleotide excision repair Nonhomologous end joining Homologous recombination Mismatch repair

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 17RQ: Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication?...

See similar textbooks

Similar questions

Which of the following does the enzyme primase synthesize? DNA primer RNA primer Okazaki fragments phosphodiester linkage
Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication? Both eukaryotic and prokaryotic DNA polymerases build off RNA primers made by primase Eukaryotic DNA replication requires multiple replication forks, while prokaryotic replication uses a single origin to rapidly replicate the entire genome DNA replication always occurs in the nucleus Eukaryotic DNA replication involves more polymerases than prokaryotic replication.
vvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNA
10. A picture of a replication bubble is shown below. でイトイOpイ TT 3 Primer 5'-CUU-3" is being used to replicate this picce of DNA. What strand this primer will anneal to: the upper or the lower? Write what product of RNA replication would be the first five nucleotides that had been added onto the primer by DNA pol. Mark the 5' and 3' ends. lin
1. The diagram below depicts a DNA replication fork in a biological cell. The primer is shown by an arrow 5'-3'. A ATTATGTCTGGCCTTGAGTAAGGCTAATCACAT GCGTA GCAT Primer BTAATA TCATTC CGATT From the DNA diagram above, which ends (indicated as A, B, C & D) of the DNA template strand are the 5' and a. which are 3' ends? b. Which way is the direction of movement of the replication fork? Right or left of the figure. Which of the parental strands are the templates for leading (continuous) and lagging (discontinuous) strand synthesis?. Top or bottom strand. С. I d. Give the sequence of the five base long primer that is shown as an arrow in the diagram above 5' 3' Give the sequence of the next four bases that would be added to the growing end of the primer e. 5' 3'
33.Choose the DNA nucleotide sequence that would be complementary to the following strand (note: pay attention to DIRECTION of replication): 5' GTAGTCA 3' a 3' UATUAGA 5' b. 5' TGACTAC 3' 3' ACGACTG 5' 5' UGACUAC 3'. 5.Using agarose gel electrophoresis to analyze DNA, short DNA travels the long DNA. a faster than slower than at the same speed as d. Question 6 Which type of bonds link the individual nucleotides together in DNA? Glycosidic bond Peptide bond Phosphodiester bond Electrostatic bond a e Hydrogen bond Question 7 A typical engineered plasmid vector often contains the following features except a A poly linker region Origin of replication A signal peptide An antibiotic resistant gene a. b. C. C. d.
Considening the structure of DNA, what kind of bonds hold one nucleotide to another within one side of the DNA molecule? O hydrogen O phosophodiester O lonic peptide
1.Make a flow diagram to describe each of the prokaryotic DNA repair mechanism 2. Give 2 examples of DNA damage and explain the impact the damage has on the sequence
Which of the following enzymes in E. coli synthesizes new DNA at sites of DNA damage during base excision repair and nucleotide excision repair? Telomerase O DNA Polymerase III ● DNA Polymerase I O None of these enzymes Excision DNA polymerase
22.124 Give two reasons why bacterial cells am wred for recombinant DNA procedures. Nucleic Acids 1015 22.125 What role do plasmids play in recombinant Polymerase Chain Reaction (Section 22.15) 22.131 What is the function of the polymerase chain DNA procedures? 22.126 Describe what occurs when a particular restric- reaction? tion enzyme operates on a segment of double- stranded DNA. 22.127 Describe what happens during transformation. 22.128 How are plasmids obtained from E, coli bacte- 22.132 What is the function of the enzyme DNA polymerase in the PCR process? 22.133 What is a primer and what is its function in the PCR process? 22.134 What are the four types of substances needed to carry out the PCR process? ria? 22.129 A particular restriction enzyme will cleave DNA Sequencing (Section 22.16) DNA between A and A in the sequence AAGCTT in the 5'-to-3' direction. Draw a dia- gram showing the structural details of the "sticky ends" that result from cleavage of the following DNA segment.…
1. The image shown in Figure 1 below represents a strand of DNA following replication. The black lines present above the top and below bottom strands of DNA represent the phosphodiester backbone of the molecule. Examine the DNA strands and locate any sites that are damaged, mismatched, or otherwise require repair. Indicate where in the strand the specific lesion is located, and provide a detailed overview of the post-replicative repair process that would likely be used to rectify the lesion. Assume that each lesion, even those that are located in close proximity will be repaired separately. CH, CH, OCH, CH, OCH₂CH, GATCCGAATCGGCTAGGATCGGCATCCGATTCGATCGGCATCCGATCGCTAGCO CH, CH, CH, CH, CH, TACGATCGATC CTAGGATTA CCGACCCTAGCCGTAGGGTAACGTAGCCGTAGGCTAGCGACCGGGGATGCTAGCTAG Figure 1: Graphical Representation of a strand of dsDNA containing errors and damage following replication
5. DNA is made of two strands that are antiparallel. If one strand runs from 3' to 5' direction the other one will go from 5' to 3' direction. During replication or transcription, whatever the process is, it will always follow the 5' to 3' direction using the 3' to 5' directed strand as the template strand. Therefore, if following is the DNA sequence 5'-CCG ATC GCA CAA-3' a) Using this sequence as template after transcription no protein can be translated. Why? I. Presence of start codon II. Absence of start codon III. Due to mutation b) If you want to start the translation, what change you need in the second codon (from 5' to 3' direction)? I. Substitution of C with G II. No change III. Deletion of C IV. Both I & III