1. The diagram below depicts a DNA replication fork in a biological cell. The primer is shown by an arrow 5'-3'. A ATTATG GGCCTT GAGTAAGGCTAATCACATG Prime TA CAT BTAA From the DNA diagram above, which ends (indicated as A, B, C & D) of the DNA template strand are the 5' and a. which are 3' ends? b. Which way is the direction of movement of the replication fork? Right or left of the figure. Which of the parental strands are the templates for leading (continuous) and lagging (discontinuous) strand С. synthesis?. Top or bottom strand. I d. Give the sequence of the five base long primer that is shown as an arrow in the diagram above 5' 3' e. Give the sequence of the next four bases that would be added to the growing end of the primer 5' 3'

1. The diagram below depicts a DNA replication fork in a biological cell. The primer is shown by an arrow 5'-3'. A ATTATG GGCCTT GAGTAAGGCTAATCACATG Prime TA CAT BTAA From the DNA diagram above, which ends (indicated as A, B, C & D) of the DNA template strand are the 5' and a. which are 3' ends? b. Which way is the direction of movement of the replication fork? Right or left of the figure. Which of the parental strands are the templates for leading (continuous) and lagging (discontinuous) strand С. synthesis?. Top or bottom strand. I d. Give the sequence of the five base long primer that is shown as an arrow in the diagram above 5' 3' e. Give the sequence of the next four bases that would be added to the growing end of the primer 5' 3'

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Which of the following molecules is a nitrogen base that would be found in 1 po DNA? (check all that apply) * Adenine Guanine Uracil Baycil Thymine Qualine Cytosine Lenovo esc -> @ # 2 7 8. tab W e r y u i d f g. k a S 31 C V alt alt ctri .... V -
25. The restriction enzymes Kpnl and Acc651 recognize and cleave the same 6-bp sequence. You have a plasmid and a linear DNA strand that both contain a Kpnl and Acc651 sequence in the same orientation as shown below. You digest both DNA pieces with both enzymes and then attempt to ligate the sticky ends, followed by treatment with DNA ligase. What will happen? 5' GGTACC3' 5' G G T ACC 3' 3' CCATGG 5' y CCATGGS Kpnl Acс651 A) You will produce sticky ends but the two types of ends will not ligate. Instead, you may produce a small amount of religated plasmid where the digested plasmid sequence re-inserts. B) You will produce a recombinant plasmid in which the linear DNA strand is ligated in between the two sites, suitable for cloning. C) You will produce blunt ends that will not ligate because the two restriction enzymes will both operate on both of the sites. D) All the DNA will be completely digested as if you had applied a general DNAse enzyme.
14. What term describes this change + LYNAS age to DRZAT 15. Now, transcribe and translate the DNA strand below. Remember to use the start and stop sequences. ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG
You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTATGTGTAACTTGTCAT 5’
4. Below is a replication fork. This is half of a replication bubble. 3' 3' a. Draw a circle to indicate the location of the helicase and an arrow to show the direction it is moving. e. b. On each DNA template, draw just one RNA primer (short, thick line) and the new DNA (longer). Label 5' and put an arrow head on 3' ends. c. The top strand would be the circle one: (leading strand / lagging strand) d. RNA primase and helicase are both what type of biomolecules (polymers) is the catalyst that adds new nucleotides of DNA.
Explain why H is 5' and E is 3'.
Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'
1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the sequence for the complimentary DNA sequence 2. Written below is the DNA sequence of a gene: T A C C T A A G C G C C G G T C A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence 3. Written below is the DNA sequence of a gene: T A C G T G T T T A C T C C A C A T G A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence
In the figure below, does A or B represent a site of DNA me ylation? 5' 3' Edit CpG TA A G.CAT M A L TCTA AGAT B 15' 3'
Following is the nucleotide sequence in a segment of a strand of DNA 5'- AATTGGCTCTATAAT-3' Give the nucleotide sequence of the DNA strand complemantary to sequence given above B Give the sequence of nucleotide in the Mrna that would be synthesized if the complementary strand in the answer above is used as a template during transcription
The following is a figure that depicts telomerase extending a telomere. -aaucccaauc ttag telomere The lagging strand template for DNA replication of this section of the chromosome is: a. Strand A Ob. Cannot be determined from the information given above O C. Not needed due to telomerase activity O d. Strand B O e. Strand C
Identify the sites of lagging strand synthesis. Select all that are true. B A 5 O a. C O b. D O c. A O d. B