solve only 3 and typed answer please 1. What are the differences/ similarities between the followings: - (a)Elastase and Chymotrypsisn; (b) Dimer and tetramer; (c) ring and helix; (d)Globular and fibrous protein; (e) Collagen and Elastin2. Explain the method used for stabilizing the crosslinks between twopolypeptide chanis3. What forces in the polypeptide chain occurs to make a binding site. Alsogive the role of AA sequence in the rest of the part of polypeptide chain.

1 a) ELASTASE CHYMOTRYPSIN 1 SERINE PROTEASE SERINE PROTEASE 2 Produced by exocrine tissue…

Answered: 1. What are the differences/…

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 10TYK

See similar textbooks

Similar questions

10. What are the steps involved in the ubiquitination of proteins? (select all that apply) a. E1 activates ubiquitin by hydrolyzing ATP to ADP and Pi to generate a thioester bond between ubiquitin C-terminus and an E1 Cysteine residue b. E1 activates ubiquitin by hydrolyzing ATP to AMP and PPI to generate a thioester bond between ubiquitin C-terminus and an E1 Cysteine residue c. E1 transfers activated ubiquitin to E2 enzymes through a transthioesterification reaction d. E2 enzymes directly add ubiquitin to substrate e. E2 enzymes directly add ubiquitin to HECT E3 Ligases f. E2 enzymes directly add ubiquitin to RING E3 Ligases g. E2 enzymes directly add ubiquitin to substrate bound to HECT E3 Ligases h. E2 enzymes directly add ubiquitin to substrate bound to RING E3 Ligases 11. How is ubiquitination regulated? (select all that apply) a. Substrate selection for ubiquitination is mediated by E1 enzymes b. Substrate selection for ubiquitination is mediated by E2 enzymes c. Substrate…
2
(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21
2. The following tyrosine-phosphorylated polypeptides were tested as substrates of protein tyrosine phosphatase, an important enzyme in cellular signal transduction. The pTyr in bold signifies the tyrosine residue that is phosphorylated. The binding affinities of the polypeptide substrates to the enzyme were found to follow the order: (a) > (c) - (d) >> (b). (a) Asp-Ala-Asp-Glu-pTyr-Leu-lle-Pro-Gln-Gln-Gly (b) Pro-Val-Pro-Glu-pTyr-lle-Asn-Ala-Ser-Val (c) Asp-Ala-Glu-Glu-pTyr-Leu-Val-Pro-Gln-Gln-Gly (d) Asp-Asn-Leu-Tyr-pTyr-Trp-Asp-Glu-Asn-Ser-Ser In addition to the presence of the phosphorylated tyrosine residue, what amino acid a) properties of the polypeptides accounts for the relative order of binding affinities to the enzyme? b) the active site of the phosphatase enzyme that are responsible for the affinity of substrate binding? Assume a pH of 7.4 at the enzyme active site. (Note a phosphatase uses phosphate substrate) What amino acids have side chains that would indicate they are…
2. Of the two sequences, which is more likely to have helical structure. Explain. a) -Glu-Asp-Glu-Glu-Asp-Leu- b) -Glu-Leu-Asp-Arg-Val-Lys-
1. Which of the following is true about phosphodiester linkage? a) 3'-phosphate group of one nucleotide unit is joined to the 5'-hydroxyl group of the next nucleotide b) 3'-phosphate group of one nucleotide unit is joined to the 3'-hydroxyl group of the next nucleotide c) 5'-phosphate group of one nucleotide unit is joined to the 3'-hydroxyl group of the next nucleotide d) 5'-phosphate group of one nucleotide unit is joined to the 5'-hydroxyl group of the next nucleotide
1.Draw these phosphorylated structures as they would be connected in a polinucleotide (e.g.RNA) in the order A-B. / Show how they combine to form the polynuleotide (i.e. only the end product). Show at any one of these structures where the glycosidic bond occurs 2.Sanger sequencing revealed the sequence of an oligonucleotide to be: d-AGATGCCTGACT. Draw a diagram of the gel banding pattern post capillary electrophoresis i.e. where on the gel would the fragments feature
6) Proteins can be modified by phosphorylation, which adds a phosphate group to the hydroxyl group of serine, threonine, or tyrosine residues. The R-group for phosphoserine is shown at right. A) The image below is an Isoelectric focusing strip that shows the unphosphorylated protein-of-interest (in blue). To which side of the unphosphorylated protein would you expect to see the phosphorylated protein? (Draw an arrow to indicate direction). Briefly justify your answer. un-phosphorylatable: Low pH Justify: B) To study the effects of phosphorylation, researchers often mutate a Ser/Thr to appear as though it is always phosphorylated or never phosphorylated at a particular site. What amino acid substitution should you use to preserve similar dimensions as Ser (or Thr) but make the side chain appear to be: constitutively (always) phosphorylated: Justify: Ser or Thr → O O=P-O O I CH₂ Ser or Thr➜ Phosphoserine High pH
8. NMR measurements have shown that poly-lysine is a random coil at pH 7 but becomes a helix when the pH is raised above 10. If the same type of folding behavior is observed, what should be the pH dependence of poly-glutamate? A) Helix at pH 7 but random coil at pH 10 B) Random coil at pH 3 but helix at pH 7 C) Random coil at pH 7 but helix at pH 10 D) Helix at pH 3 but random coil at pH 7
A heptapeptide was found to have an amino acid composition of Asp, Leu, Lys, 2 Met, Phe and Tyr. (a) Trypsin has no effect on the heptapeptide. (b) The phenyl thiohydantoin released by Edman degradation revealed phenylalanine in the N-terminus. (c) Brief chymotrypsin treatment yielded several products including a dipeptide and a tetrapeptide. The amino acid composition of the tetrapeptide was Leu, Lys, and Met. (d) Cyanogen bromide treatment yielded a dipeptide, a tetrapeptide, and free Lys. What is the amino acid sequence of this heptapeptide? Answer Format: (Three letter abbreviation with dash ie., Ala-Gly-…) *
Electrophoresis is performed at PH 6.8 on a mixture of mutated hemoglobin that differ from normal haemoglobin (Hb) only by the substitution of one amino acid- Hb X: Val replaced par Glu - Hb Y: Asp replaced by Leu - Hb Z: Glu replaced by Lys What will be the order of migration between cathode and anode of these mutated Hb compared to normal Hb? Justify your answer.
The diagram to the right illustrates the inter-actions of the amino acid side chains of two a-helical polypeptide strands in a coiled-coil, viewed end-on and projected along the helix axes from the N-terminal to the C-terminal end. Are the macrodipoles of the two a- helices oriented parallel or anti-parallel? For this projec- tion is the positive end of the macro-dipole in the sur- face of the paper or below the surface? f C b g e d a' a d' g b' f'

SEE MORE QUESTIONS

Recommended textbooks for you

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS