Draw these phosphorylated structures as they would be connected in a polinucleotide (e.g.RNA) in the order A-B. / Show how they combine to form the polynuleotide (i.e. only the end product). Show at any one of these structures where the glycosidic bond occurs     2.Sanger sequencing revealed the sequence of an oligonucleotide to be: d-AGATGCCTGACT.  Draw a diagram of the gel banding pattern post capillary electrophoresis i.e. where on the gel would the fragments feature

Q: 9. The T conformation of the hemoglobin tetramer is stabilized (in part) by a salt linkage between…

A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…

Q: A peptide was cleaved into two smaller peptides with cyanogen bromide (CNBr) and into two different…

A: The given peptide sequences are: CNBr 1: Gly-Thr-Lys-Ala-Glu CNBr 2: Ser-Met Tryp 1:…

Q: Draw a double-stranded DNA molecule (using different colors for each) model should clearly represent…

A: A G T A C C G G G C A A the sequence of DNA

Q: C4GUCAGUCAGUCO/ Use the codon chart to determine the following RNA strand in amino acids (Remember…

A: Genetic code The relationship between the sequence of amino acids in a polypeptide chain and…

Q: 1. Which one of these indicated groups or bonds: hydroxyl; phosphate; triphosphate; nitrogen base;…

A: DNA replication is a mechanism that involves breaking and building bonds. Replication occurs in 3…

Q: 4. a. Draw the structure of the dipeptide Valine-Serine at its isoelectric point. The side chain for…

A: Amino acids are building block of protein and peptides. There are 20 naturally occurring amino acid,…

Q: 63. Given the single stranded DNA shown below (written 5' to 3') and the genetic code, which…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: How many different sequence possibilities are there for a double-stranded RNA polymer that is 6…

A: At each base, one can have any of the four different bases (A,U,C or G). Therefore for the first…

Q: novel protein is described that functions best at pH 10.5, and contains a beta strand on one side.…

A: Proteins are unbranched polymers constructed from 22 standard α-amino acids. They have four levels…

Q: Consider an a-helix secondary structure. a. Propose a 12-residue amino acid sequence that(assuming…

A: In the study of protein structures, the alpha-helix is a prominent secondary structure characterized…

Q: 12. Draw the structure of a reverse Hoogsteen A•U base pair with two hydrogen bonds. Draw hydrogen…

A: 12. Reverse Hoogsteen base pairs:  In a reverse Hoogsteen base pair, one of the bases is rotated 180…

Q: 1. Which of the following structures could the following polypeptide form? And why? The non- polar…

A: A polypeptide is an amino acid polymer that is held together by peptide bonds. Amino acids have…

Q: Express the following DNA nucleotide bases into amino acids

A: According to the central dogma of molecular biology, the information stored in the DNA is first…

Q: A nonapeptide was treated with dithiothreitol to reduce any disulfide bridges, then partially…

A: Amino acids are the basic unit of the peptide and proteins. They are joined via the peptide bonds to…

Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…

A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…

Q: (a) () The isoelectric point (pl) of the protein, i.e., the pH at which the overall electrostatic…

A: The isoelectric point (pI) is the pH of a solution at which a given protein has a net charge of…

Q: 2. As we've seen previously, peptide bonds involving the amino acid proline can populate both…

A: Michaelis-Menten model of enzyme kinetics is a very useful model which describe the relationship…

Q: 1. Explain why the primary structure sequence -Lys-Leu-Trp-Asp- may promote a-helix formation while…

A: The formation of α helix is occurred due to attachment of H of N of Cα of first (n) amino acid to…

Q: 5-Bromouridine is known to induce mutations in DNA. One of the characteristics of this compound is…

A: 5-Bromouridine is a uridine subordinate with a Bromo substituent at the fifth carbon. Br -Urd is…

Q: Draw the structure of 2 five-mers (draw backbones with side chains shown as R groups) forming a beta…

A: The secondary structures of proteins are the alpha helix and beta sheets. Alpha helix forms a spiral…

Q: Case B: An oligopeptide has the ff amino acid composition: 2 Phe, 2 Met, 2 Glu, 1 Arg, 1 Val, 1 Leu,…

A: Peptides are formed of amino acids connected through an amide/peptide bond. The peptide bond is…

Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…

A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…

Q: 1. Which of the following is true about phosphodiester linkage? a) 3'-phosphate group of one…

A: Phosphodiester linkage is the covalent bond that connects two nucleotides in a DNA or RNA strand. It…

Q: IS the nitrogenous base "U" the image add the atom (s) on to the sugar that are necessary to convert…

A: UTP is a nucleotide of RNA and an energy carrier.

Q: Cyclic nucleotides (e.g., CGMP, CAMP) frequently make use of the same parts of the ribose ring;…

A: cGMP and cAMP are cyclic nucleotides where a cyclic bond is formed between sugar and phosphate…

Q: 17. Mutation can be caused by the alternative base pairing that arise due to tautomerization and…

A: Base pairing is a fundamental concept in the structure and function of DNA. The four nitrogenous…

Q: Show below is a polypeptide comprised of 3 α-helices and 5 β-sheets joined by randomcoil.…

A: Tertiary structure of a protein is the 3-D structure of the polypeptide after it has undergone…

Q: Draw double-stranded DNA (two basepairs long with one AT basepair and one GC basepair). Your drawing…

A: Basic structure of DNA and the structure of different nitrogenous bases.

Q: Discuss the differences between the Z-Form, A-form and B-form Dna

A: DNA (Deoxyribonucleic acid) is a molecule which is present in the nucleus of the cell. It contains…

Q: Which statement is FALSE regarding when a pyrimidire base is incorporated into a deoxynucleoside?…

A: DNA ( deoxyribonucleic acid) is a type of nucleic acid.  Nucleic acids are present inside the…

Q: 2. Amino acid analysis of the a heptapeptide gave the following residues: Asp Glu Leu Lys Met Tyr…

A: The objective of the question is to determine the sequence of amino acids in a heptapeptide based on…

Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser…

A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and…

Q: You are analyzing the peptide ala-ile-glu-lys-phe-val- tyr-cys. If you treat the peptide with…

A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…

Q: 7). You analyze a biosynthetic pathway in an unknown strain of bacteria. Given the following data…

A: 3-phosphoglycerate (PGA) is used by bacteria as the starting material to synthesize serine. From…

Q: 1. How many different tripeptides are possible? How many carboxyl terminals of polypeptide chains…

A: Tripeptides are composed of three amino acids. There are 20 naturally occurring  amino acids . A…

Q: nbonucleotide in automated RNA synthesis. Point to the functional groups

A: In automated RNA synthesis, a ribo nucleotide is used. When we look at epinephrine signalling, we…

Q: A -O-P-O-CH₂ -O NH ₂ (X) (Y) B C

A:

Q: You are working on a protein with the following sequence in an area of interest.…

A: Proteins are made up of different amino acids. Some amino acids have ionizable side chains. All…

Q: 14. What is the difference between a deoxyribonucleotide and a dideoxyribonucleotide?   Question…

A: 14.ANSWER;-C)  A dideoxynucleotide is missing a 3'- hydroxyl group on its sugar. Explain;- The…

Q: choices: purine or pyrimidine ribose or deoxyribose 1-9? hydrogen or phosphodiester 1-9? an -OH…

A: Nucleotides are the building blocks of DNA and RNA, two essential nucleic acids in living organisms.…

Q: H2N 1.) Look carefully at this nucleotide: N- || НО-Р-О- N. OH a.) Number the carbons in the sugar…

A: DNA is a long, double-stranded, helical molecule composed of building blocks called…

Q: Which of the following deoxyoligonucleotides will hybridize with the following sequence 5' AGACTGGTC…

A: Deoxyoligonucleotides are short strands of DNA that are composed of a sequence of…

Q: write the structure of the following nucleotides: 1. 5'-dGMP 2. 5'-dGDP 3. 5'-dGTP 4. 5'-GTP 5.…

A: The nucleotides are the phosphoric acid esters of nucleosides with the phosphate at the C-5'…

Q: 2. The diagram to the right shows the change in the structure of the C-terminal portion of each of…

A: Therefore, the final answer is: (a) Without the His146 residue, CPA-treated hemoglobin would have a…

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.