. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer. GGGGCCUUG 5′ TATAACCCCGGAACACTATAC 3′ Which of the following will be the first DNA nucleotide added to the primer? a. C b. G c. A d. T
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
1. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer.
GGGGCCUUG
5′ TATAACCCCGGAACACTATAC 3′
Which of the following will be the first DNA
a. C
b. G
c. A
d. T
2. A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a template for
a. 5' TTACCGAAT 3'
b. 3′ AATGGCTTA 5′
c. 5′ TAAGCCATT 3′
d. 3′ TTACCGAAT 5′
3. This complex assembles and organizes nucleosomes and contributes to gene repression
a. SWR1 Complex
b. ISWI Complex
c. SWI/SNF Complex
d. SWI Complex
4. Amino acids at the N-terminal end of eukaryotic polypeptides that contain the information required for the post-translational processing and determining the extra-cellular destination of the nascent polypeptides.
a. Kozak Sequence
b. Signal Sequence
c. Chaperone Sequence
d. Sigma Sequence
5. Genes in a bacteriophage that are expressed after expression of genes that initiate the lytic cycle
a. Immediate Early Genes
b. Delayed Early Genes
c. Late Early Genes
d. Late Genes
Step by step
Solved in 2 steps