BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
10th Edition
ISBN: 9781305967359
Author: STARR
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 11SA
The phrase
| a. timing of |
| b. directionality of DNA synthesis |
| c. number of phosphate groups |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Thymine dimers are __________ crosslinks formed between two pyrimidines on the ______ strand of DNA.
a.
interstrand; same
b.
intrastrand; same
c.
interstrand; different
d.
intrastrand; different
when a cell to divide, its DNA must be replicated (copied).
a.List the most important participating components and their functions in replication
b.why is it important that the replication goes right and that relatively few mutations occur during the replication?
c.Will the offspring of the individual who received a mutation inherit the mutation
DNA replication is described as semi-conservative because _____.
A. one leading strand and one lagging strand are produced in DNA replication
B. all new DNA strands are synthesized continuously
C. one new DNA strand is synthesized discontinuously
D. DNA replication can never produce DNA molecules which consist of both original DNA stands
E. one DNA strand is the template while the complementary strand is not
Chapter 8 Solutions
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Ch. 8 - Which is not a nucleotide base in DNA? a. adenine...Ch. 8 - What are the base-pairing rules for DNA? a. A-G,...Ch. 8 - Similarities in ___________ are the basis of...Ch. 8 - One species DNA differs from others in its...Ch. 8 - In eukaryotic chromosomes, DNA wraps around...Ch. 8 - The chromosome number ________ . a. refers to a...Ch. 8 - Prob. 7SACh. 8 - DNA replication requires ________ . a. DNA...Ch. 8 - Energy that drives the attachment of a nucleotide...Ch. 8 - When DNA replication begins, _______ . a. the two...
Ch. 8 - The phrase 5to3 refers to the _________ . a....Ch. 8 - After DNA replication, a eukaryotic chromosome...Ch. 8 - Prob. 13SACh. 8 - _________ is an example of reproductive cloning....Ch. 8 - Match the terms appropriately. ___ nucleotide ___...Ch. 8 - Determine the complementary strand of DNA that...Ch. 8 - Woolly mammoths have been extinct for about 4,000...Ch. 8 - Xeroderma pigmentosum is an inherited disorder...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Cystic Fibrosis is caused by which of the following? a. Replacement of three nucleotides with a new three nucleotide sequence b. Addition of three nucleotides c. Deletion of three nucleotidesarrow_forwardDNA replication is carried out by a ________ enzyme. a. Helicase b. Polymerase c. Kinase d. Topoisomerasearrow_forwardWhen DNA replication begins,_______ . a. the two DNA strands unwind from each other b. the two DNA strands condense for base transfers c. old strands move to find new strandsarrow_forward
- Use the following information to answer the next two questions.A DNA antisense strand contains the following nucleotide base sequence:CGA TTT GGT TGAFrom this, what is the nucleotide sequence of the mRNA strand that is transcribed? a. AUG CCC UUG GUC b. CGT AAA CCA ACT c. AUC GGG UUG GUC d. GCU AAA CCA ACUarrow_forwardTake each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…arrow_forwardThe main function of a DNA molecule is to______ . a. store heritable information b. carry a translatable message c. form peptide bonds between amino acidsarrow_forward
- Indicate whether each of the following statementsrelating to aspects of DNA replication is true or false.a. The lagging strand grows in the same direction as thereplication fork moves.b. Growth of the leading strand involves the productionof Okazaki fragments.c. Lagging strands always involve “daughter” DNAsegments, and leading strands always involve“parent” DNA segments.d. The enzyme DNA ligase effects the unwinding of aDNA double helix.arrow_forwardTranscription is similar to DNA replication because both processes_______ . a. use the same enzyme b. copy both strands c. require the same nucleotides d. proceed in the 5′ to 3′ directionarrow_forwardCan you please answer number 9 and all of the sub partsarrow_forward
- Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from________ . a. the nucleotide c. DNA polymerase b. phosphate-group transfers from ATParrow_forwardDetermine whether each statement isTRUE or FALSE.a. In eukaryotic chromosomes, DNA replication begins at a single point in the chromosome and proceeds in two directions.b. The bonds between the sugars and phosphates are broken during DNA replication.c. The elongation of the leading strand during DNA synthesis progresses away from the replication fork.d. Each DNA molecule resulting from replication has one original strand and one new strand.e. The difference in how the leading and lagging strands of DNA molecules are synthesized is due to DNA polymerase adding new nucleotides only to the 3’ end of a growing strand, and the strands are anti-parallel.arrow_forwardRepair enzymes _____. a. repair only mutations that occur in mitochondrial DNA b. can only repair mutations that occur prior to replication c. can only repair mutations that occur after replication d. repair only DNA mismatch mutations e. repair only mutations that arise during replicationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY