SurveySenior

docx

School

New Jersey City University *

*We aren’t endorsed by this school

Course

336

Subject

Philosophy

Date

Oct 30, 2023

Type

docx

Pages

5

Uploaded by anv690

Report
The following questions refer to how you feel. Please read each question carefully and then circle a number between 1 and 10 that most accurately reflects how you feel. The results are completely anonymous so please be honest and think carefully about the questions before circling a number. 1. When you look at your face in the mirror, how pleased are you? 1 2 3 4 5 6 7 8 9 10 not pleased at all very pleased 2. When you look at your body in the mirror, how pleased are you? 1 2 3 4 5 6 7 8 9 10 not pleased at all very pleased 3. How pleased are you with your physical appearance overall? 1 2 3 4 5 6 7 8 9 10 not pleased very pleased at all 4, How smart do you think you are?
1 2 3 4 5 6 7 8 9 10 not smart at all very smart 5. How much ability do you think you have to do well in school and academics? 1 2 3 4 5 6 7 8 9 10 very little very high ability ability 6. If an employer hired you, how confident are you that you could handle any job you were asked to do? 1 2 3 4 5 6 7 8 9 10 not at all confident very confident 7. How good of an athlete do you think you are compared to others of your gender? 1 2 3 4 5 6 7 8 9 10 not good at all very good 8. How attractive do you think you are to members of the opposite sex? 1 2 3 4 5 6 7 8 9 10 not attractive at all very attractive 9. How confident are you that you can keep a romantic partner happy in a relationship? 1 2 3 4 5 6 7 8 9 10
not at confident very confident 10. How confident are you in your ability to please your partner during sex? 1 2 3 4 5 6 7 8 9 10 not at all confident Very confident 11. How happy are you with the person you are? 1 2 3 4 5 6 7 8 9 10 not at all very happy happy 12. Do you feel that you have several good qualities? 1 2 3 4 5 6 7 8 9 10 definitely not definitely 13. How often do you feel that you are a failure? 1 2 3 4 5 6 7 8 9 10 always never 14. Do you feel that you are worthy of being loved? 1 2 3 4 5 6 7 8 9 10 Definitely not Definitely
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
15.) Did you receive a lot of compliments and praise from your parent(s)/guardian(s)when you were growing up (ages 1-13 years)? 1 2 3 4 5 6 7 8 9 10 Definitely did not Definitely did 16.) When growing up (ages 1-13), did you feel that you had a warm, loving, supportive family and home that was always there and would always be there for you? 1 2 3 4 5 6 7 8 9 10 Definitely did not Definitely did 17.) When you were growing up (ages 1-13), did your parent(s)/guardian(s) give you the feeling that you could become anything you wanted to be when you grew up? 1 2 3 4 5 6 7 8 9 10 Definitely did not Definitely did 18.)When growing up (ages 1-13), how supportive were your parent(s)/guardian(s)? 1 2 3 4 5 6 7 8 9 10 Not at all supportive Very supportive 19.) When growing up (ages 1-13), how much did your parent(s)/guardian(s) criticize you? 1 2 3 4 5 6 7 8 9 10 Always critized me Never critized me
20.) Were you bullied at school or in your neighborhood when growing up? 1 2 3 4 5 6 7 8 9 10 never bullied always bullied 21.). Did things occur in your family when you were growing up that made you feel ashamed or upset or confused? 1 2 3 4 5 6 7 8 9 10 Definitely not Definitely 22). How often did you receive physical punishments (e.g., slapping, spanking, beating), when you were growing up? 1 2 3 4 5 6 7 8 9 10 Never received Received frequently 23.) When you received physical punishments, were they severe? 1 2 3 4 5 6 7 8 9 10 Never severe Almost always severe 24). What is you gender: F or M 25.) What is your age: a. 18-30 b. 31-45 c. 46-59 d. 60-plus

Browse Popular Homework Q&A

Q: in java I need help with making a preorder traversal method in a binary search tree, It uses…
Q: Pandas dataframe.
Q: Write a C++ program that ask user to enter 10 grade and determine the average of grades. first you…
Q: Find the value of (a, b) so that sin 12x lim x+0 x³ cos 12x Write your answer in the form of (a, b)…
Q: Respiratory alkalosis is recognized as a respiratory rate in excess of that which maintains normal…
Q: The compound KCIO4 decomposes when heated according to the equation below. KCIO4(s) →KCI (s) + 2 0₂…
Q: Name the two places in the eukaryotic cell where the cell component Ribosome, mRNA, tRHA and rRNA…
Q: 11. Which of the following caused your patient's osteonecrosis a. Vessel injury b. Prior steroid…
Q: Problem 19. Evaluate the definite integral: sin3 2x dx.
Q: Determine if the specified linear transformation is (a) one-to-one and (b) onto. Justify your…
Q: Program - Python Write a  function min_max() that takes a list s as an argument, and print the…
Q: A force of magnitude F acting in the x-direction on a 1.0-kg particle varies in time as shown in the…
Q: ruct a Venn diagram illustrating the following sets. = (Film 1, Film 2, Film 3, Film 4, Film 5, Film…
Q: Transcribe the strand below: ACGCTACCGTTAGCCGACATCGGGGACACTGACTCG
Q: Machine 1 Time (sec) 1 2 3 Amount (gal) 0.4 0.8 1.2 The slope of the graph of Machine 1 is 4 The…
Q: Find the slope of the tangent line to the curve defined by 6x5 + 8xy +y2 = -13 at (-1,1). The slope…
Q: A light bulb manufacturer guarantees that the mean life of a certain type of light bulb is at least…
Q: Market demand for widgets is p = 160 - 2Q. Whether there is just one firm selling widgets or many…
Q: O COOH (1) SOCI₂ (2) AlCl3
Q: A 6.9-kg bowling ball is attached to the end of a nylon (Young's modulus 3.7x10⁹ N/m²) cord with a…
Q: Select the correct classification for the given 1st order ODE: (3x² - 2xy) dx + (xy-2y2)dy = 0 O…
Q: The following table contains the possible actions and payoffs of players 1 and 2. Player 2 Cooperate…