Bio 30 Unit C Lesson 4

doc

School

Mount Royal University *

*We aren’t endorsed by this school

Course

Subject

Biology

Date

Jan 9, 2024

Type

doc

Pages

Uploaded by MagistratePanther411

Biology 30: Unit C Lesson Assignment 4 DNA Replication, Translations and Transcription Name: /49 Answer by clicking in the line below the question and typing your answer. Please answer in complete sentences. Part One: DNA Structure and Replication (21 marks) 1. Who were the co-discovers of the double-helix model of DNA? \ Francis Crick and James Watson /1 2. Briefly describe the events of DNA replication. DNA replication initiates with helicase, acting as the unzipping enzyme, disrupting the hydrogen bonds between DNA bases. This action triggers the unwinding of the double helix. Single- stranded binding proteins then adhere to these exposed strands to prevent reannealing. Primase, subsequently, synthesizes RNA primers on both strands. The process differs for each strand, described as leading and lagging. On the leading strand, primase kickstarts a 5' - 3' directionality, enabling continuous synthesis of new bases by DNA polymerase for this section. Conversely, on the lagging strand, primase generates RNA primers intermittently, forming Okazaki fragments. Ligase plays a pivotal role, sealing the gaps between these fragments, facilitating efficient construction by DNA polymerase. Upon completion, each DNA product comprises one parental and one newly synthesized strand, signifying successful replication. /4 Bio.30.13Asn © NorthStar Academy 2009 1

3. Use a diagram to explain what is meant by semi-conservative replication. If possible, place your drawing from “Procedure” step 2 (scanned or done digitally) below. If it is not possible, please submit it as a separate file with this assignment to Moodle. In the fundamental process of DNA replication, a double-stranded DNA molecule generates two identical copies; this involves unwinding the double helix and exposing its individual strands. The template strand--one of these--acts as a blueprint for synthesizing a new complementary strand. This process operates under the governance of a fundamental principle: Adenine (A) pairs with Thymine (T), and Cytosine (C) pairs with Guanine (G) - this is known as base pairing. Helicase enzymes unwind and separate the DNA strands, whereas DNA Polymerase synthesizes new ones by adding complementary nucleotides in accordance with a template. Each freshly synthesized DNA double helix harbors an original (parental) strand alongside one that is completely novel; hence we term this process as semiconservative replication--each daughter molecule of DNA embodies one inherited from its predecessor along side another never seen strand. The resulting two DNA molecules mirror the original DNA molecule and each other identically, in terms of their base sequence. This accuracy in base pairing - coupled with replication's semiconservative nature - guarantees precise genetic information transmission from one cell generation to another. /2 Bio.30.13Asn © NorthStar Academy 2009 2

4. Proofreading enzymes scan the strands of DNA to check the nitrogen base pairings. Explain why these enzymes are important. During DNA replication, specialized enzymes diligently examine the newly formed strands, meticulously seeking out and rectifying any anomalies like nitrogen base mispairings or incorrect nucleotide insertions. This rigorous scrutiny serves a crucial role in upholding the accuracy of the genetic code, acting as a safeguard against potential mutations that might trigger genetic disorders or interfere with fundamental cellular operations. These vigilant proofreading enzymes play an integral part in maintaining the precision of DNA replication, thereby safeguarding the integrity and stability of the genetic material. Their dedicated oversight ensures the precise inheritance and faithful transmission of genetic instructions across successive generations. /2 5. A drug holds complementary nitrogen bases with such strength that the DNA molecule is permanently fused in the shape of a double helix. Predict whether or not this drug might prove harmful. Provide your reasons. When considering the impact of a drug permanently binding to form a double helix molecule, it's crucial to recognize its potential harm. The initial step of DNA replication involves unwinding the double helix structure, enabling the synthesis of new strands. If a drug were to permanently fuse and interfere with this critical unwinding step, it would obstruct DNA replication, a process vital for cellular growth, repair, and reproduction. Any disruption caused by the drug in this fundamental process would have far-reaching consequences. It could impede essential biological processes, leading to negative cascades affecting cellular function and potentially compromising the overall health of the organism. Essentially, such interference from the drug disrupts the fundamental machinery of life, with ramifications extending to cellular and organismal levels, rendering it harmful. /2 6. Complete “Thought Lab 18.1: DNA Deductions” on page 629 of the textbook. Follow the “Procedure” and complete the “Analysis” questions for this activity. Procedure a. Place your completed table from Step 1 of the procedure below. (Remember: your percentages should add up to 100%) Bio.30.13Asn © NorthStar Academy 2009 3

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

/3 b. If possible, place your drawing from “Procedure” step 2 (scanned or done digitally) below. If it is not, please submit it as a separate file with this assignment to Moodle. (For your drawing make sure you use your percentages determined in Step 1 to build your DNA) /4 Bio.30.13Asn © NorthStar Academy 2009 4

Analysis c. Answer “Analysis” questions 1 to 3 When considering the impact of a drug permanently binding to form a double helix molecule, it's crucial to recognize its potential harm. The initial step of DNA replication involves unwinding the double helix structure, enabling the synthesis of new strands. If a drug were to permanently fuse and interfere with this critical unwinding step, it would obstruct DNA replication, a process vital for cellular growth, repair, and reproduction. Any disruption caused by the drug in this fundamental process would have far-reaching consequences. It could impede essential biological processes, leading to negative cascades affecting cellular function and potentially compromising the overall health of the organism. Essentially, such interference from the drug disrupts the fundamental machinery of life, with ramifications extending to cellular and organismal levels, rendering it harmful. There would be different nucleotide composition of our original DNA sample compared to the nucleotide composition of a tissue sample from the gametes of the same mouse. Because the gametes of animals have half the genetic materials of the somatic cells. There would be half the amount, and they could possibly be in even slightly different forms due to crossing over in the formation of the gametes. Yes, because a mouse and a deer are different organisms. They would have different DNA sequences. Many genes are conserved across species with small changes. There ' s only so many ways to write a code for each protein. Once you have completed all of the questions, submit your work to your teacher. /3 Part Two: Transcription and Translation (19 marks) 1. Transcription is the process by which RNA is made from DNA. It occurs in the nucleus. Print off the next page. Label the box with the x in it near the nucleus with the word TRANSCRIPTION and proceed to color the bases according to the key below  Thymine = orange  Adenine = dark green  Guanine = purple  Cytosine = yellow Bio.30.13Asn © NorthStar Academy 2009 5

 Uracil = brown Color the strand of DNA dark blue (D) and the strand of RNA light blue (R). Color the nuclear membrane (E) gray. Translation occurs in the cytoplasm, specifically on the ribosomes. The mRNA made in the nucleus travels out to the ribosome to carry the message of the DNA. Here at the ribosome, that message will be translated into an amino acid sequence. Color the ribosome light green (Y) and note how the RNA strand threads through the ribsosome like a tape measure and the amino acids are assembled. The RNA strand in the translation area should also be colored light blue, as it was colored in the nucleus. Label the box with the X in the translation area with the word TRANSLATION. Important to the process of translation is another type of RNA called Transfer RNA (F) which function to carry the amino acids to the site of protein synthesis on the ribosome. Color the tRNA red. A tRNA has two important areas. The anticodon, which matches the codon on the RNA strand. Remember that codons are sets of three bases that code for a single amino acid. Make sure you color the bases of the anticodon the same color as the bases on your DNA and RNA strand - they are the same molecules! At the top of the tRNA is the amino acids. There are twenty amino acids that can combine together to form proteins of all kinds, these are the proteins that are used in life processes. When you digest your food for instance, you are using enzymes that were originally proteins that were assembled from amino acids. Each tRNA has a different amino acid which link together like box cars on a train. Color all the amino acids (M) pink. If possible, place your coloured and labelled diagram (scanned or digitally photographed) below. If it is not, please submit it as a separate file with this assignment to Moodle. Bio.30.13Asn © NorthStar Academy 2009 6

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

2. How many different kinds of bases can be found on DNA? Thymine, guanine, adenine, and cytosine. /1 3. What base is found on RNA but not on DNA? Uracil /1 4. How many bases are in a codon? How many bases are in an anticodon? 3 bases in anticodon, and 3 bases in codon. /1 5. How many amino acids are attached to a single transfer RNA? only one amino acid is attached to a single transfer RNA /1 6. Where does transcription occur? Where does translation occur? Translation occurs in the cytoplasm, specifically at the ribosomes. It's the process where the mRNA is decoded by ribosomes to produce a specific protein. /1 7. In what ways is the structure of mRNA similar to DNA? How does mRNA differ from DNA? You may use a Venn diagram to structure your response. mRNA: Single Strand: Unlike DNA, mRNA consists of a single strand. Ribose Sugar: mRNA utilizes ribose sugar in its structure. Shorter Structure: Generally shorter in length compared to DNA. Contains Uracil Base: Instead of thymine, mRNA incorporates uracil as one of its bases. Shares with DNA: Both have four nucleotides. Both carry crucial genetic information. Guanine and cytosine form base pairs within mRNA. DNA: Double Strand: DNA forms a double-helix structure with two complementary strands. Deoxyribose Sugar: Utilizes deoxyribose sugar in its backbone. Longer Structure: Typically longer in length compared to mRNA. Contains Thymine Base: Unlike mRNA, DNA contains thymine as one of its bases. Shares with mRNA: Both contain four nucleotides. Both are essential carriers of genetic instructions. Guanine and cytosine are paired with each other within DNA./4 Bio.30.13Asn © NorthStar Academy 2009 8

Part Three: RNA and Protein Synthesis Simulation (9 marks) Complete the RNA and Protein Synthesis Simulation by clicking on the ‘RNA and Protein Synthesis Gizmo’ course on the course page. The link to the page is found below. https://ghla.myghsd.ca/mod/lti/view.php?id=17913 Read carefully through the Exploration Guide and follow the steps described. Analysis 1. How did the strand of mRNA you made compare to the left side (the anti-sense strand) of the unzipped DNA strand? What was the same? What was different? The mRNA strand bears a resemblance to the anti-sense strand of DNA in terms of the order and sequence of nucleotides. Both sequences—mRNA and the anti-sense strand—exhibit similar arrangements of adenine (A), cytosine (C), and guanine (G) nucleotides, maintaining an identical order. However, where the anti-sense DNA strand holds thymine (T) nucleotides, the mRNA strand replaces these with uracil (U). This distinction arises due to the transcription process where mRNA is synthesized complementary to the anti-sense DNA strand, swapping thymine with uracil. Thus, while the overall sequence alignment and order of nucleotides remain consistent between the two strands, the divergence in nucleotide composition between thymine and uracil marks the primary difference /2 2. The UAC anticodon is the initiator. What amino acid is this anticodon always attached to? It’s attached to methionine alaways. /1 3. Describe what happens when you add the third tRNA anticodon to the mRNA strand. After the addition of the third tRNA anticodon to the mRNA strand, the ribosome orchestrates the formation of a peptide bond between the amino acid carried by the second tRNA and the incoming amino acid from the third tRNA. This linkage results in the creation of a chain of three amino acids bound to the third tRNA. Subsequently, the second tRNA, having donated its amino acid, dissociates from the ribosome. The newly formed chain of amino acids, now connected to the third tRNA, undergoes further processing within the ribosome. Following completion, the synthesized protein, enveloped within a membrane, is directed to its designated cellular destination for its specific function. /2 4. The original sense strand of DNA had the following nucleotide sequence: TACCCCGCGAAATATTTCCTAATT a. What is the nucleotide sequence of the mRNA transcribed from this DNA template? AUGGGGCGCUUUAUAAAGGAUUAA /2 Bio.30.13Asn © NorthStar Academy 2009 9

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

b. What is the amino acid sequence of the polypeptide that is produced from the mRNA strand? Met-Gly-Arg-Phe-Ile-Lys-Asp-Stop /2 Bio.30.13Asn © NorthStar Academy 2009 10

Bio 30 Unit C Lesson 4

Related Documents