
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 9.L1, Problem 2WC
Summary Introduction
To determine:
- The duplicate of the given DNA molecule.
- The direction of replication and what causes the leading and lagging strands to replicate differently.
- How this is semiconservative replication and whether the new strands are identical to the old ones.
Introduction:
Replication of DNA involves the retention of one of the old strands in each new molecule of DNA. It occurs because the DNA strands follow base-complementarity rules.
Expert Solution & Answer

Trending nowThis is a popular solution!

Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 9 Solutions
Foundations in Microbiology
Ch. 9.1 - 1. Define heredity, genetics, genome, gene,...Ch. 9.1 - 2. Compare the basic nature of genetic material in...Ch. 9.1 - 3. Explain how DNA is organized and packaged.Ch. 9.1 - 4. Describe the chemical structure of DNA and Its...Ch. 9.1 - Prob. 5ELOCh. 9.1 - 6. Describe the process of DNA replication as it...Ch. 9.1 - 1. Compare the genetic material of eukaryotes,...Ch. 9.1 - 2. Characterize the organization of genetic...Ch. 9.1 - Prob. 3CYPCh. 9.1 - 4. What are the fundamental building blocks of DNA...
Ch. 9.1 - 5. Describe what is meant by the antiparallel...Ch. 9.1 - 6. Explain the synthesis of the leading and...Ch. 9.1 - 7. Name several characteristics of DNA structure...Ch. 9.2 - Prob. 7ELOCh. 9.2 - Prob. 8ELOCh. 9.2 - 9. Describe the different types of RNA and their...Ch. 9.2 - Prob. 10ELOCh. 9.2 - 11. Describe the genetic code, codons, and...Ch. 9.2 - 12. Recount the participants and steps in...Ch. 9.2 - Prob. 13ELOCh. 9.2 - 8. How is the language of a gene expressed?Ch. 9.2 - Prob. 9CYPCh. 9.2 - 10. Construct a table that compares the structure...Ch. 9.2 - Prob. 11CYPCh. 9.2 - Prob. 12CYPCh. 9.2 - Prob. 13CYPCh. 9.2 - Prob. 14CYPCh. 9.2 - 15. Briefly describe the events in translation.Ch. 9.2 - Prob. 16CYPCh. 9.2 - 17. Summarize how bacterial and eukaryotic cells...Ch. 9.2 - Prob. 18CYPCh. 9.3 - 14. Explain the functions of operons in bacterial...Ch. 9.3 - 15. Describe the main features of the lactose...Ch. 9.3 - 16. Describe the main features of repressible...Ch. 9.3 - 17. Summarize some aspects of genetic control by...Ch. 9.3 - 19. What is an operon? Describe the functions of...Ch. 9.3 - 20. Compare and contrast the lac operon and...Ch. 9.3 - Prob. 21CYPCh. 9.3 - 22. At which levels of DNA regulation do small...Ch. 9.4 - Prob. 18ELOCh. 9.4 - Summarize the causes and types of mutations and...Ch. 9.4 - Prob. 20ELOCh. 9.4 - Compare beneficial and detrimental effects of...Ch. 9.4 - Explain what is meant by the terms mutation and...Ch. 9.4 - Describe the primary causes, types, and outcomes...Ch. 9.4 - Explain the purposes behind replica plating and...Ch. 9.5 - Explain recombination in bacteria and what it...Ch. 9.5 - Describe the main features of conjugation and its...Ch. 9.5 - Prob. 24ELOCh. 9.5 - Identify the basic processes involved in...Ch. 9.5 - Discuss transposons and their importance to...Ch. 9.5 - Compare conjugation, transformation, and...Ch. 9.5 - Explain the differences between general and...Ch. 9.5 - By means of a flowchart, show the possible jumps...Ch. 9.6 - Explain the major elements of viral genetics.Ch. 9.6 - Compare aspects of the genetics of DNA and RNA...Ch. 9.6 - Explain why some viruses must enter the nucleus to...Ch. 9.6 - Explain the difference between positive-strand and...Ch. 9.6 - Outline the basic steps in the replication cycles...Ch. 9.L1 - What is the smallest unit of heredity (genotype)?...Ch. 9.L1 - Prob. 2MCQCh. 9.L1 - The nitrogen bases in DNA are bonded to the a....Ch. 9.L1 - DNA replication is considered semiconservative...Ch. 9.L1 - In DNA, adenine is the complementary base for...Ch. 9.L1 - The base pairs are held together primarily by a....Ch. 9.L1 - Why must the lagging strand of DNA be replicated...Ch. 9.L1 - Messenger RNA is formed by _______ of a gene on...Ch. 9.L1 - Prob. 9MCQCh. 9.L1 - Prob. 10MCQCh. 9.L1 - Prob. 11MCQCh. 9.L1 - Prob. 12MCQCh. 9.L1 - Prob. 13MCQCh. 9.L1 - Prob. 14MCQCh. 9.L1 - Which genetic material could be transmitted...Ch. 9.L1 - Prob. 16MCQCh. 9.L1 - Which of the following is present in prokaryotes...Ch. 9.L1 - Multiple Matching. Fill in the blanks with all the...Ch. 9.L1 - Prob. 1CSRCh. 9.L1 - Prob. 2CSRCh. 9.L1 - Explain how it would be possible for A. baumannii...Ch. 9.L1 - Prob. 1WCCh. 9.L1 - Prob. 2WCCh. 9.L1 - The following sequence represents triplets on DNA:...Ch. 9.L1 - Describe the actions οf all of the enzymes...Ch. 9.L1 - Prob. 5WCCh. 9.L1 - Examine the following series of words and identify...Ch. 9.L2 - Knowing that retroviruses operate on the principle...Ch. 9.L2 - Using the piece of DNA in writing-challenge...Ch. 9.L2 - Why will a mistake in the RNA code alone not...Ch. 9.L2 - The enzymes required to carry out transcription...Ch. 9.L2 - Prob. 5CTCh. 9.L2 - Activation, transcription, and translation of the...Ch. 9.L2 - Explain the mechanisms by which RNA can control...Ch. 9.L2 - Ex�Ιain how epigenetics is related to the...Ch. 9.L2 - Use the concepts of chapters, letters, a whole...Ch. 9.L2 - From figure 9.17, step 3. Label each part of the...Ch. 9.L2 - Examine figure 8.11, and explain which type of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY