
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 9.4, Problem 18ELO
Summary Introduction
To determine:
- The definition of mutation.
- How mutant forms are identified.
Introduction:
Although rare, genes do go through permanent changes. These changes can result in a permanent change in the physical or physiological characters of the organism. These changes are called mutations and they are the origin of evolution.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 9 Solutions
Foundations in Microbiology
Ch. 9.1 - 1. Define heredity, genetics, genome, gene,...Ch. 9.1 - 2. Compare the basic nature of genetic material in...Ch. 9.1 - 3. Explain how DNA is organized and packaged.Ch. 9.1 - 4. Describe the chemical structure of DNA and Its...Ch. 9.1 - Prob. 5ELOCh. 9.1 - 6. Describe the process of DNA replication as it...Ch. 9.1 - 1. Compare the genetic material of eukaryotes,...Ch. 9.1 - 2. Characterize the organization of genetic...Ch. 9.1 - Prob. 3CYPCh. 9.1 - 4. What are the fundamental building blocks of DNA...
Ch. 9.1 - 5. Describe what is meant by the antiparallel...Ch. 9.1 - 6. Explain the synthesis of the leading and...Ch. 9.1 - 7. Name several characteristics of DNA structure...Ch. 9.2 - Prob. 7ELOCh. 9.2 - Prob. 8ELOCh. 9.2 - 9. Describe the different types of RNA and their...Ch. 9.2 - Prob. 10ELOCh. 9.2 - 11. Describe the genetic code, codons, and...Ch. 9.2 - 12. Recount the participants and steps in...Ch. 9.2 - Prob. 13ELOCh. 9.2 - 8. How is the language of a gene expressed?Ch. 9.2 - Prob. 9CYPCh. 9.2 - 10. Construct a table that compares the structure...Ch. 9.2 - Prob. 11CYPCh. 9.2 - Prob. 12CYPCh. 9.2 - Prob. 13CYPCh. 9.2 - Prob. 14CYPCh. 9.2 - 15. Briefly describe the events in translation.Ch. 9.2 - Prob. 16CYPCh. 9.2 - 17. Summarize how bacterial and eukaryotic cells...Ch. 9.2 - Prob. 18CYPCh. 9.3 - 14. Explain the functions of operons in bacterial...Ch. 9.3 - 15. Describe the main features of the lactose...Ch. 9.3 - 16. Describe the main features of repressible...Ch. 9.3 - 17. Summarize some aspects of genetic control by...Ch. 9.3 - 19. What is an operon? Describe the functions of...Ch. 9.3 - 20. Compare and contrast the lac operon and...Ch. 9.3 - Prob. 21CYPCh. 9.3 - 22. At which levels of DNA regulation do small...Ch. 9.4 - Prob. 18ELOCh. 9.4 - Summarize the causes and types of mutations and...Ch. 9.4 - Prob. 20ELOCh. 9.4 - Compare beneficial and detrimental effects of...Ch. 9.4 - Explain what is meant by the terms mutation and...Ch. 9.4 - Describe the primary causes, types, and outcomes...Ch. 9.4 - Explain the purposes behind replica plating and...Ch. 9.5 - Explain recombination in bacteria and what it...Ch. 9.5 - Describe the main features of conjugation and its...Ch. 9.5 - Prob. 24ELOCh. 9.5 - Identify the basic processes involved in...Ch. 9.5 - Discuss transposons and their importance to...Ch. 9.5 - Compare conjugation, transformation, and...Ch. 9.5 - Explain the differences between general and...Ch. 9.5 - By means of a flowchart, show the possible jumps...Ch. 9.6 - Explain the major elements of viral genetics.Ch. 9.6 - Compare aspects of the genetics of DNA and RNA...Ch. 9.6 - Explain why some viruses must enter the nucleus to...Ch. 9.6 - Explain the difference between positive-strand and...Ch. 9.6 - Outline the basic steps in the replication cycles...Ch. 9.L1 - What is the smallest unit of heredity (genotype)?...Ch. 9.L1 - Prob. 2MCQCh. 9.L1 - The nitrogen bases in DNA are bonded to the a....Ch. 9.L1 - DNA replication is considered semiconservative...Ch. 9.L1 - In DNA, adenine is the complementary base for...Ch. 9.L1 - The base pairs are held together primarily by a....Ch. 9.L1 - Why must the lagging strand of DNA be replicated...Ch. 9.L1 - Messenger RNA is formed by _______ of a gene on...Ch. 9.L1 - Prob. 9MCQCh. 9.L1 - Prob. 10MCQCh. 9.L1 - Prob. 11MCQCh. 9.L1 - Prob. 12MCQCh. 9.L1 - Prob. 13MCQCh. 9.L1 - Prob. 14MCQCh. 9.L1 - Which genetic material could be transmitted...Ch. 9.L1 - Prob. 16MCQCh. 9.L1 - Which of the following is present in prokaryotes...Ch. 9.L1 - Multiple Matching. Fill in the blanks with all the...Ch. 9.L1 - Prob. 1CSRCh. 9.L1 - Prob. 2CSRCh. 9.L1 - Explain how it would be possible for A. baumannii...Ch. 9.L1 - Prob. 1WCCh. 9.L1 - Prob. 2WCCh. 9.L1 - The following sequence represents triplets on DNA:...Ch. 9.L1 - Describe the actions οf all of the enzymes...Ch. 9.L1 - Prob. 5WCCh. 9.L1 - Examine the following series of words and identify...Ch. 9.L2 - Knowing that retroviruses operate on the principle...Ch. 9.L2 - Using the piece of DNA in writing-challenge...Ch. 9.L2 - Why will a mistake in the RNA code alone not...Ch. 9.L2 - The enzymes required to carry out transcription...Ch. 9.L2 - Prob. 5CTCh. 9.L2 - Activation, transcription, and translation of the...Ch. 9.L2 - Explain the mechanisms by which RNA can control...Ch. 9.L2 - Ex�Ιain how epigenetics is related to the...Ch. 9.L2 - Use the concepts of chapters, letters, a whole...Ch. 9.L2 - From figure 9.17, step 3. Label each part of the...Ch. 9.L2 - Examine figure 8.11, and explain which type of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY