ANATOMY & PHYSIOLOGY: AN INTEGRATIVE AP
3rd Edition
ISBN: 9781264013470
Author: McKinley
Publisher: MCGRAW-HILL LEARNING SOLN.(CC)
expand_more
expand_more
format_list_bulleted
Question
Chapter 9.4, Problem 9WDL
Summary Introduction
To determine:
The functions of synovial fluid in synovial joints.
Concept introduction:
Synovial joints are the most commonly joints found in human body. They are freely movable joints characterized by articular cartilage, synovial membrane, synovial fluid, fibrous capsule and synovial fluid.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 9 Solutions
ANATOMY & PHYSIOLOGY: AN INTEGRATIVE AP
Ch. 9.1 - Prob. 1LOCh. 9.1 - Prob. 2LOCh. 9.1 - Prob. 3LOCh. 9.1 - What is the relationship between mobility and...Ch. 9.1 - Are all fibrous joints also synarthroses? Explain...Ch. 9.2 - Prob. 4LOCh. 9.2 - Prob. 3WDLCh. 9.2 - LEARNING OBJECTIVE
5. Describe the location and...Ch. 9.2 - Prob. 4WDLCh. 9.2 - Prob. 6LO
Ch. 9.2 - Prob. 5WDLCh. 9.3 - Prob. 7LOCh. 9.3 - Prob. 1WDTCh. 9.3 - Prob. 6WDLCh. 9.3 - Prob. 8LOCh. 9.3 - Prob. 7WDLCh. 9.4 - Prob. 9LOCh. 9.4 - Prob. 10LOCh. 9.4 - Prob. 11LOCh. 9.4 - What are the basic characteristics of all types of...Ch. 9.4 - Prob. 9WDLCh. 9.4 - LEARNING OBJECTIVE
12. Explain the movement of a...Ch. 9.4 - Prob. 13LOCh. 9.4 - Prob. 2WDTCh. 9.4 - Prob. 10WDLCh. 9.5 - Prob. 14LOCh. 9.5 - Prob. 11WDLCh. 9.5 - Prob. 15LOCh. 9.5 - Prob. 16LOCh. 9.5 - Prob. 17LOCh. 9.5 - Prob. 3WDTCh. 9.5 - How do flexion and extension differ? What...Ch. 9.5 - Prob. 18LOCh. 9.5 - Prob. 13WDLCh. 9.5 - Prob. 19LOCh. 9.5 - Prob. 14WDLCh. 9.6 - Prob. 20LOCh. 9.6 - Prob. 21LOCh. 9.6 - What is the difference between the effort arm and...Ch. 9.6 - LEARNING OBJECTIVE
22. Compare and contrast the...Ch. 9.6 - Prob. 16WDLCh. 9.7 - Prob. 23LOCh. 9.7 - Prob. 24LOCh. 9.7 - Prob. 17WDLCh. 9.7 - Prob. 25LOCh. 9.7 - LEARNING OBJECTIVE
26. Explain why the...Ch. 9.7 - Prob. 18WDLCh. 9.7 - Prob. 27LOCh. 9.7 - Prob. 28LOCh. 9.7 - Prob. 19WDLCh. 9.7 - Prob. 29LOCh. 9.7 - Prob. 30LOCh. 9.7 - How do the glenohumeral and hip joints compare...Ch. 9.7 - Prob. 31LOCh. 9.7 - Prob. 32LOCh. 9.7 - What are the functions of each of the...Ch. 9.7 - LEARNING OBJECTIVE
33. Describe the talocrural...Ch. 9.7 - Prob. 22WDLCh. 9.8 - Prob. 34LOCh. 9.8 - Prob. 35LOCh. 9.8 - Prob. 23WDLCh. 9 - _____ 1. The greatest range of mobility of any...Ch. 9 - _____ 2. A movement of the foot that turns the...Ch. 9 - _____ 3. A _______ is formed when two bones...Ch. 9 - Prob. 4DYBCh. 9 - Prob. 5DYBCh. 9 - Prob. 6DYBCh. 9 - Prob. 7DYBCh. 9 - Prob. 8DYBCh. 9 - Prob. 9DYBCh. 9 - Prob. 10DYBCh. 9 - Prob. 11DYBCh. 9 - Prob. 12DYBCh. 9 - List and describe all joints that are functionally...Ch. 9 - How do a hinge joint and a pivot joint compare...Ch. 9 - Prob. 15DYBCh. 9 - Prob. 16DYBCh. 9 - Most ankle sprains are overinversion injuries....Ch. 9 - What are the main supporting ligaments of the...Ch. 9 - Prob. 19DYBCh. 9 - What are the similarities and differences between...Ch. 9 - Prob. 1CALCh. 9 - Prob. 2CALCh. 9 - Prob. 3CALCh. 9 - Prob. 4CALCh. 9 - Prob. 5CALCh. 9 - During soccer practice, Erin tripped over the...Ch. 9 - Prob. 2CSLCh. 9 - Jackie visits her physician because she is...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeFundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
The Skeletal System; Author: Professor Dave Explains;https://www.youtube.com/watch?v=f-FF7Qigd3U;License: Standard YouTube License, CC-BY