
Concept explainers
Introduction:
In living organisms, chemical energy is stored in organic compounds and this energy is converted to other forms of energy. All living organisms need energy to carry out various biological functions.All the

Answer to Problem 7STP
Correct answer :
The correct answer is option B. the conversion of ADP to ATP.
Explanation of Solution
Explanation/justification for the correct answer:
Option B. the conversion of ADP to ATP−In living organisms, chemical energy is stored in organic compounds and this energy is converted to other forms of energy. Adenosine triphosphate or ATP is the most important biological molecule that provides chemical energy.ATP is a multipurpose storehouse of chemical energy that can be used by cells in a variety of reactions. An ATP molecule is made of an adenine base, a ribose sugar and three phosphate groups. Energy is stored in the phosphate bond formed when ADP receives a phosphate group and becomes ATP. The conversion of ADP to ATP stores energy for powering cellular activities in organisms.
Hence this is the correct option.
Explanation for incorrect answer:
Option A. the breaking of lipid chains−When lipid chains are broken down by hydrolysis energy is released from fat. In this case energy is not stored for cellular processes. Hence this is not the correct option.
Option C. the synthesization of proteins from RNA codons- When proteins are synthesized from RNA by using the codon sequence as a template, energy is used for the process and not stored for cellular activities. Hence this is not the correct option.
Option D. the transportation of ions across the membrane- Energy is used for transportation of ions across the plasma membrane against the concentration gradient. It is not stored during this process.Hence this is not the correct option.
Chapter 9 Solutions
Glencoe Biology (Glencoe Science)
Additional Science Textbook Solutions
Biology: Life on Earth (11th Edition)
Concepts of Genetics (12th Edition)
Chemistry: The Central Science (14th Edition)
Campbell Biology (11th Edition)
Chemistry: An Introduction to General, Organic, and Biological Chemistry (13th Edition)
Microbiology: An Introduction
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





