
Concept explainers
Introduction:
A cell grows until it reaches its size limit, then it either stops growing or divides. Most cells undergo division. Cell division helps a cell to reproduce and makes the organism grow and heal certain injuries. Most cells are less than 100μm in diameter. The ratio of surface area to volume is the key factor that limits the size of a cell.By remaining small cells have a higher ratio of surface area to volume and they can sustain themselves more easily.

Answer to Problem 5A
Correct answer :
The correct answer is option B. 3:1
Explanation of Solution
Explanation/justification for the correct answer:
Option B. 3:1- Surface area of a cell refers to the area covered by the plasma membrane through which the nutrients and wastes must pass through. Volumerefers to the space taken up by the contents of the cell. To calculate the surface area of the cube, we have to multiply length times width times the number of sides. To calculate the volume we have to multiply length times width times height.
Hence this is the correct option.
Explanation for incorrect answer:
Option A. 2:1−To calculate the surface area of the cube, we have to multiply length times width times the number of sides. To calculate the volume we have to multiply length times width times height.
Hence, this is not the correct option.
Option C. 4:1- To calculate the surface area of the cube, we have to multiply length times width times the number of sides. To calculate the volume we have to multiply length times width times height.
Hence this is not the correct option.
Option D. 6:1- To calculate the surface area of the cube, we have to multiply length times width times the number of sides. To calculate the volume we have to multiply length times width times height.
Hence this is not the correct option.
Chapter 9 Solutions
Glencoe Biology (Glencoe Science)
Additional Science Textbook Solutions
Brock Biology of Microorganisms (15th Edition)
Campbell Biology (11th Edition)
Human Anatomy & Physiology (2nd Edition)
Chemistry: An Introduction to General, Organic, and Biological Chemistry (13th Edition)
Microbiology: An Introduction
Anatomy & Physiology (6th Edition)
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





