HUMAN ANATOMY W/MODIFEDMAS AP
9th Edition
ISBN: 9780137444250
Author: Marieb
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 9, Problem 6RQ
Summary Introduction
To review:
The function of the various components of synovial joints.
Introduction:
Joints are the sitesof attachment fortwo bones. They are classified functionally into synarthroses, amphiarthroses, and diarthroses. Synarthroses are immobile joints, amphiarthroses can be moved slightly, and diarthroses are completely movable joints. On the basis of their structures, joints are classified into fibrous, cartilaginous, and synovial joints.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 9 Solutions
HUMAN ANATOMY W/MODIFEDMAS AP
Ch. 9 - Define each of the following terms: synarthrosis,...Ch. 9 - What types of cartilage are found in a symphysis...Ch. 9 - List the six features common to all synovial...Ch. 9 - Prob. 4CYUCh. 9 - Prob. 5CYUCh. 9 - Prob. 6CYUCh. 9 - Prob. 7CYUCh. 9 - Prob. 8CYUCh. 9 - Prob. 9CYUCh. 9 - Prob. 10CYU
Ch. 9 - Prob. 11CYUCh. 9 - What structures contribute most to stability of...Ch. 9 - Which forearm bone forms part of the elbow joint?...Ch. 9 - Name the intracapsular ligaments found in the hip...Ch. 9 - Which ligament is injured in an ankle sprain...Ch. 9 - The articular surfaces of the knee contribute...Ch. 9 - Prob. 17CYUCh. 9 - Prob. 18CYUCh. 9 - Prob. 19CYUCh. 9 - Match the joint types in the key to the...Ch. 9 - Prob. 2RQCh. 9 - In general, the most important factor (s)...Ch. 9 - Characteristics of a symphysis include (a)...Ch. 9 - Most nerve fibers to synovial joints (a) monitor...Ch. 9 - Prob. 6RQCh. 9 - Prob. 7RQCh. 9 - Prob. 8RQCh. 9 - Prob. 9RQCh. 9 - Prob. 10RQCh. 9 - Prob. 11RQCh. 9 - Prob. 12RQCh. 9 - Name two speci�c examples of each: hinge joint,...Ch. 9 - Prob. 14RQCh. 9 - Prob. 15RQCh. 9 - Prob. 16RQCh. 9 - Examine the thorax using a skeleton or an...Ch. 9 - Prob. 18RQCh. 9 - Prob. 19RQCh. 9 - Prob. 20RQCh. 9 - Prob. 21RQCh. 9 - Prob. 22RQCh. 9 - Prob. 23RQCh. 9 - Prob. 1CRCAQCh. 9 - Dan Park, an exhausted anatomy student, was...Ch. 9 - Prob. 3CRCAQCh. 9 - Prob. 4CRCAQCh. 9 - Prob. 5CRCAQCh. 9 - On the evening news, Samantha heard that the deer...Ch. 9 - Prob. 7CRCAQCh. 9 - Prob. 8CRCAQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Fundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College

Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Types of Human Body Tissue; Author: MooMooMath and Science;https://www.youtube.com/watch?v=O0ZvbPak4ck;License: Standard YouTube License, CC-BY