Concept explainers
Apart from genome size, what factors make complete assembly of a eukaryotic genome more difficult than assembly of a genome from a species of Bacteria or Archaea?
To explain:
What are the factors that make entire assembly of a eukaryotic genome is more difficult than the assembly of a genome from a species of Archaea and Bacteria.
Concept introduction:
The number of base pairs constitutes an organisms, genetic constitution is referred as the genome size. Using comparative genomics, it is determined that the Archaea and Bacteria genome reveals the strong correlation between the open reading frame (ORFs) and genome size. Despite of an organism, every DNA mega base pair in the cells of prokaryotes encodes about 1000 open reading frame (ORFs) and genome size increases, then the number of genes also increases proportionally.
Explanation of Solution
An essential challenge of acquiring the entire eukaryotic genome sequence includes that it has a multiple number of chromosome that frequently contains an extensive run of repetitive DNA, the genes are generally consists of introns that can constitute an increased percentage of the genome than compared to the exons and they continuously have a prolonged number of non-coding RNAs. It contains organelles and sometimes it also contains nucleomorphs that their possess genome.
Want to see more full solutions like this?
Chapter 9 Solutions
Brock Biology of Microorganisms (15th Edition)
- What is a database? What types of information are stored within adatabase? Where does the information come from? Discuss theobjectives of a genome database.arrow_forward1b) In 1995, the first free-living organism to have its genome completely sequenced was Haemophilus influenzae, a bacteria. In the following year, the baker’s yeast Saccharomyces cerevisiae was the first eukaryote genome sequence to be fully sequenced. The complete sequencing of the human genome and related organisms represent one of the greatest scientific achievements in the history of mankind. Write an essay on the importance of genome studies in general.arrow_forwardConsidering that prokaryote genomes do not have large introns, how is it possible to move a eukaryotic gene into a transformed bacterium, since they lack a spliceosome?arrow_forward
- In 1995, the first free-living organism to have its genome completely sequenced was Haemophilus influenzae, a bacteria. In the following year, the baker’s yeast Saccharomyces cerevisiae was the first eukaryote genome sequence to be fully sequenced. The complete sequencing of the human genome and related organisms represent one of the greatest scientific achievements in the history of mankind.Elaborate on the importance of genome studies in general.arrow_forwardWhy do geneticists studying eukaryotic organisms often construct cDNA libraries, whereas geneticistsstudying bacteria almost never do? Why might bacterial geneticists have difficulties constructing cDNA libraries even if they wanted to?arrow_forwardYou have assembled a new prokaryotic genome and are annotating the genes. If you were to search for highly conserved sequences necessary for normal gene expression, what type of annotation are you doing? Group of answer choices ad hoc annotation homology based annotation preliminary annotation ab initio annotationarrow_forward
- What advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications where the use of a genomic library is necessary to provide information that a cDNA library cannot.arrow_forwardAssume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to sequence a human genome. Suppose the length of the human genome is 3x109 bps. What is the depth (i.e., coverage) of the sequencing?arrow_forwardWhat is the main reason for using a cDNA library rather than a genomic library to isolate a human gene from which you wish to make large quantities of the human protein in bacteria? How will you identify clones of interest?arrow_forward
- Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she suggests that you write a computer program that will identify the exons of protein- coding genes directly from the sequence of the human genome. In preparation for that task, you decide to write down a list of the features that might distinguish protein- coding sequences from intronic DNA and from other sequences in the genome. What features would you list?arrow_forwardThe genome of a typical bacterium contains about 5 x 106 base pairs, and can be replicated in about 30 minutes. The human genome is 600 times larger (3 × 10° base pairs), and at the rate of a bacterium, it would require 300 hours (~12 days) to be replicated; yet the entire human genome can be replicated within several hours. How is this possible?arrow_forwardThe following DNA sequences were used to generate a contig from a genome sequencing project. ttcagattttccccg gctaaagctccgaa gccattaacgcc tttagcatactacggcgtta aaaaccggggaaaat tccgaatcggtcattcaga How long is the fully assembled contig?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education