Bundle: Biology: The Unity and Diversity of Life, 14th + LMS Integrated for MindTap Biology, 1 term (6 months) Printed Access Card
14th Edition
ISBN: 9781305774384
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9, Problem 10SQ
Up to ______ amino adds can be encoded by an mRNA that consists of 45
- a. 15
- b. 45
- c. 90
- d. 135
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
The number of codon binding sites in an mRNA-ribosome complex that can be occupied at the same time by activated tRNA molecules is; *
A. 2
B. 3
C. 4
D. 5
Which is a characteristics of the normal genetic code? *
A. one codon can code for only one amino acid
B. one amino acid can have only one codon
C. one tRNA molecule can bind to only one codon
D. one aminoacyl-tRNA synthetase can react with only one tRNA
Which of the following describes the effect of a point mutation on amino acid identity in a protein? *
A. The identity of two amino acid must change
B. The identity of one amino acid may change
C. The identity of one amino acid must change
D. The identity of one amino acid never change
Which of the following statements is true regarding introns? *…
Which translation factor mediates the aminoacyl-tRNA entry into the A site of the ribosome?
A. EF-Tu
B. EF-Ts
C. EF-G
D. IF1
The degeneracy of the Genetic code is due to
A. a 1 to 1 correlation between single amino acids and single nucleotides
B. The fact that tRNAs can bind to mRNAs at the same time they transfer amino acids to a growing polypeptide chain
C. The fact that there is only one start codon
D. The fact that the code is non-overlapping
E. The fact that more than one codon specifying an amino acid
F. None of the above
Chapter 9 Solutions
Bundle: Biology: The Unity and Diversity of Life, 14th + LMS Integrated for MindTap Biology, 1 term (6 months) Printed Access Card
Ch. 9 - A chromosome contains many different genes that...Ch. 9 - A binding .site for RNA polymerase is called a ___...Ch. 9 - An RNA molecule is typically ______; a DNA...Ch. 9 - RNAs form by_____; proteins form by ________. a....Ch. 9 - The main function of a DNA molecule is to ________...Ch. 9 - The main function of an mRNA molecule is to ___ ....Ch. 9 - Prob. 7SQCh. 9 - Prob. 1DAACh. 9 - Prob. 2DAACh. 9 - Prob. 3DAA
Ch. 9 - Prob. 4DAACh. 9 - Prob. 8SQCh. 9 - Anticodons pair with ___ . a. mRNA codons b. DNA...Ch. 9 - Up to ______ amino adds can be encoded by an mRNA...Ch. 9 - Prob. 11SQCh. 9 - Prob. 12SQCh. 9 - Prob. 13SQCh. 9 - Energy that drives translation is provided mainly...Ch. 9 - Match the terms with the best description. __...Ch. 9 - Researchers are designing and testing antisense...Ch. 9 - An anticodon has the sequence GCG. What amino acid...Ch. 9 - Each position of a codon can be occupied by one of...Ch. 9 - Prob. 4CTCh. 9 - Translate the .sequence of bases in the previous...Ch. 9 - Bacteria use the.same stop codons as eukaryotes....
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following is not a possible size (in bp) of the mature mRNA? a. 205bp b. 180bp c. 150bp d. 100bparrow_forwardGiven the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forwardThe AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? a. complementarity b. nonsense codons c. universality d. degeneracyarrow_forward
- Which of the following is the mRNA coding for the peptide trp-met-gly- ser-his? A. 5'GGUGUAUGGUCUUAC-3' B. 5'-CAUUCUGGUAUGUGG-3' C. 5'-UGGAUGGGUUCUCAU-3' D. 3'-UGGAUGGGUUCUCAU-5' E. cannot be determined since the genetic code is degeneratearrow_forwardA polypeptide is composed of 4 amino acids. How many nucleotide bases on an mRNA strand are necessary to code for the complete making of this polypeptide from initiation to termination? Be sure to include the "start" and "stop" codons. a. 18 b. 15 c. 12 d. 4arrow_forwardWhy might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic mRNA? a. If the mutation occurs in the 5' end of the start site, it will not affect the gene product. b. If the mutation occurs in the exon, it will not affect the gene product. c. If the mutation occurs in the splice site of a transcript with alternative splicing, only one gene product may affected. O d. If the mutation occurs in the intron or not in the splice site of a transcript with alternative splicing, it will nc affect the gene product. O e. If the mutation occurs in the 3' end of the start site, it will not affect the gene product. OLIE STIC N 1Aarrow_forward
- Degeneracy of the genetic code denotes the existence of which of the following? A. codons that can wobble at the 5' position B. multiple codons for a single amino acid C. codons consisting of only two bases D. base triplets that do not code for any amino acid E. codons that are not overlappingarrow_forwardWhich of the following rows identifies the mutated DNA sequence, complementary mRNA sequence, and resulting amino acid in a person with metabolic syndrome? Complementary mRNA Resulting Amino Acid Row A B D. OC. C D. D C Select one: OA A OB B Mutated DNA ATG ATG ACT ACT Metabolic syndrome is a genetic disorder with symptoms such as hypertension, elevated blood cholesterol, and low blood magnesium concentrations. This syndrome is caused by a mutation in which a cytosine nucleotide in the codon ACG is replaced by a thymine nucleotide. Use the following to answer the next AUG UAC ACU UGA Methionine Tyrosine Threonine Stoparrow_forwardWhich of the following mutations is most likely to cause a single amino acid difference during the translation of mRNA into protein? A. Single base-pair insertion B. Single base-pair deletion C. Mutations in regulatory sites D. Base-pair substitutionarrow_forward
- Complete the phrases with the correct word or words. The task is to match the lettered items with the correct numbered items. Appearing below is a list of lettered items. Following that is a list of numbered items. Each numbered item is followed by a drop-down. Select the letter in the drop down that best matches the numbered item with the lettered alternatives. a. methionine b. ribosome c. codon d. AUG e. UAC The mRNA moves out of the nucleus and attaches to a The first codon of an mRNA molecule is always As soon as the first codon is in place, a tRNA molecule arrives with the anti-codon The first tRNA to arrive always carries the amino acid called, The ribosome scoots along the mRNA to read the nextarrow_forwardYou are studying a eukaryotic gene in which translation normally begins at the second AUG in the mRNA (underlined). The sequence surrounding both AUGs is CGGAUGCACAGGACAUCCUACCUACGGAGAUGA.... Predict the effects of the following mutations on the translation of this mRNA. Present the new sequence, highlight the changes in the sequence and consider the best context for translation. a. Change the first and second C to G b. Change the first and second C to G and also change the UAC codon before the second AUG to UAG.arrow_forward_______is/are removed from a new mRNA. a. Introns c. A poly-A tail b. Exons d. Amino acidsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license