ANATOMY & PHYSIOLOGY: AN INTEGRATIVE APP
3rd Edition
ISBN: 9781266163654
Author: McKinley
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 8.11, Problem 34WDL
Summary Introduction
To describe:
The primary function of the tibia.
Concept introduction:
Tibia is also commonly known as the “shinbone”. It is one of the two bones present in the leg below the knee. It is larger than fibula and connects the knee with ankle bones. Tibia and fibula are connected by an interosseous ligament that stabilizes the positions of these two bones. It also provides a pivot for minimal rotation of these bones.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 8 Solutions
ANATOMY & PHYSIOLOGY: AN INTEGRATIVE APP
Ch. 8.1 - LEARNING OBJECTIVE
1. Compare and contrast the...Ch. 8.1 - What is the general function of the axial...Ch. 8.1 - Prob. 2LOCh. 8.1 - What is the difference between a foramen and a...Ch. 8.2 - LEARNING OBJECTIVE
3. Distinguish between the...Ch. 8.2 - Prob. 3WDLCh. 8.2 - Prob. 4LOCh. 8.2 - Prob. 5LOCh. 8.2 - Prob. 6LOCh. 8.2 - Prob. 1WDT
Ch. 8.2 - Prob. 4WDLCh. 8.2 - What bones form the middle cranial fossa, and...Ch. 8.2 - Prob. 7LOCh. 8.2 - Prob. 6WDLCh. 8.2 - Prob. 8LOCh. 8.2 - Prob. 9LOCh. 8.2 - Prob. 7WDLCh. 8.2 - In which four bones are the paranasal sinuses...Ch. 8.3 - Prob. 10LOCh. 8.3 - Prob. 11LOCh. 8.3 - Prob. 9WDLCh. 8.4 - Prob. 12LOCh. 8.4 - Prob. 2WDTCh. 8.4 - What are some features that differ between female...Ch. 8.4 - Prob. 13LOCh. 8.4 - Prob. 14LOCh. 8.4 - What are the two largest fontanelles, and when do...Ch. 8.5 - Prob. 15LOCh. 8.5 - Prob. 16LOCh. 8.5 - Prob. 12WDLCh. 8.5 - Prob. 17LOCh. 8.5 - LEARNING OBJECTIVES
18. Explain the sequence of...Ch. 8.5 - What are the secondary curves, and when do they...Ch. 8.5 - Prob. 19LOCh. 8.5 - Prob. 20LOCh. 8.5 - Prob. 3WDTCh. 8.5 - Compare the locations and functions of the...Ch. 8.5 - Prob. 15WDLCh. 8.6 - Prob. 21LOCh. 8.6 - Prob. 16WDLCh. 8.6 - Prob. 22LOCh. 8.6 - Prob. 23LOCh. 8.6 - Where specifically do the head and tubercle of a...Ch. 8.7 - Prob. 24LOCh. 8.7 - Prob. 25LOCh. 8.7 - Prob. 18WDLCh. 8.8 - Prob. 26LOCh. 8.8 - How do the sternal end and acromial end of the...Ch. 8.8 - Prob. 27LOCh. 8.8 - Prob. 20WDLCh. 8.9 - Prob. 28LOCh. 8.9 - Prob. 29LOCh. 8.9 - Prob. 21WDLCh. 8.9 - Prob. 22WDLCh. 8.9 - Prob. 30LOCh. 8.9 - Prob. 31LOCh. 8.9 - Prob. 32LOCh. 8.9 - Prob. 23WDLCh. 8.9 - Describe how the radius and ulna are positioned...Ch. 8.9 - Prob. 33LOCh. 8.9 - Prob. 34LOCh. 8.9 - List the eight carpal bones. Which of these bones...Ch. 8.10 - Prob. 35LOCh. 8.10 - LEARNING OBJECTIVES
36. Describe how the ossa...Ch. 8.10 - Prob. 37LOCh. 8.10 - WHAT DO YOU THINK?
4 Compare and contrast the...Ch. 8.10 - What three bones fuse to form the os coxae?Ch. 8.10 - Prob. 27WDLCh. 8.10 - Prob. 38LOCh. 8.10 - Prob. 39LOCh. 8.10 - How is the pelvic inlet distinguished from the...Ch. 8.10 - Prob. 40LOCh. 8.10 - Prob. 29WDLCh. 8.10 - Prob. 41LOCh. 8.10 - What are some differences in the symphysial...Ch. 8.11 - Prob. 42LOCh. 8.11 - Prob. 43LOCh. 8.11 - Prob. 44LOCh. 8.11 - Prob. 31WDLCh. 8.11 - Prob. 32WDLCh. 8.11 - Prob. 45LOCh. 8.11 - Prob. 46LOCh. 8.11 - Prob. 47LOCh. 8.11 - WHAT DO YOU THINK?
5 The medial and lateral...Ch. 8.11 - What are some bony features that are similar or...Ch. 8.11 - Prob. 34WDLCh. 8.11 - LEARNING OBJECTIVES
48. Locate and identify the...Ch. 8.11 - Prob. 49LOCh. 8.11 - Prob. 35WDLCh. 8.11 - Prob. 50LOCh. 8.11 - Prob. 36WDLCh. 8.12 - Prob. 51LOCh. 8.12 - Prob. 52LOCh. 8.12 - Prob. 37WDLCh. 8 - Prob. 1DYBCh. 8 - Which bone marking is matched with its correct...Ch. 8 - The frontal and parietal bones articulate at the...Ch. 8 - Prob. 4DYBCh. 8 - Prob. 5DYBCh. 8 - Prob. 6DYBCh. 8 - Prob. 7DYBCh. 8 - Prob. 8DYBCh. 8 - The femur articulates with the tibia at the a....Ch. 8 - Prob. 10DYBCh. 8 - Prob. 11DYBCh. 8 - Prob. 12DYBCh. 8 - What are the functions of the paranasal sinuses?Ch. 8 - Prob. 14DYBCh. 8 - Describe similarities and differences among true,...Ch. 8 - Compare and contrast the anatomic and functional...Ch. 8 - What are the primary similarities and differences...Ch. 8 - Prob. 18DYBCh. 8 - Prob. 19DYBCh. 8 - Prob. 20DYBCh. 8 - Prob. 1CALCh. 8 - Prob. 2CALCh. 8 - Prob. 3CALCh. 8 - Prob. 4CALCh. 8 - Use the following paragraph to answer questions...Ch. 8 - Prob. 1CSLCh. 8 - Prob. 2CSLCh. 8 - Forensic anthropologists are investigating...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Basic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage
Chapter 7 - Human Movement Science; Author: Dr. Jeff Williams;https://www.youtube.com/watch?v=LlqElkn4PA4;License: Standard youtube license