ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260406092
Author: HARTWELL, Leland, HOOD, Leroy, Goldberg, Michael
Publisher: Mcgraw-hill Education/stony Brook University
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 7P
The following diagram describes the mRNA sequence of part of the A gene and the beginning of the B gene of phage ϕX174. In this phage, some genes are read in overlapping reading frames. For example, the code for the A gene is used for part of the B gene, but the reading frame is displaced by one base. Shown here is the single mRNA with the codons for proteins A and B indicated.
aa# 5 6 7 8 9 10 11 12 13 14 15 16
A AlaLysGluTrpAsnAsnSerLeuLysThrLysLeu
mRNA GCUAAAGAAUGGAACAACUCACUAAAAACCAAGCUG
B MetGluGlnLeuThrLysAsnGlnAla
aa# 1 2 3 4 5 6 7 8 9
Given the following amino acid (aa) changes, indicate the base change that occurred in the mRNA and the consequences for the other protein sequence.
| a. | Asn at position 10 in protein A is changed to Tyr. |
| b. | Leu at position 12 in protein A is changed to Pro. |
| c. | Gln at position 8 in protein B is changed to Leu. |
| d. | The occurrence of overlapping reading frames is very rare in nature. When it does occur, the extent of the overlap is not very long. Why do you think this is the case? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Different species or organisms research for ecology
What is the result of the following gram stain:
positive
○ capsulated
○ acid-fast
○ negative
What
type
of stain is the image below:
capsule stain
endospore stain
gram stain
negative stain
ASM MicrobeLibrary.org Keplinger
Chapter 8 Solutions
ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is the result of the acid-fast stain below: Stock Images by Getty Images by Getty Images by Getty Images by Getty Image Getty Images St Soy Getty Images by Getty Images by Getty Images Joy Getty encapsulated O endosporulating negative ○ positivearrow_forwardYou have a stock vial of diligence 75mg in 3ml and need to draw up a dose of 50mg for your patient.how many mls should you draw up to give this dosearrow_forwardYou are recquired to administer 150mg hydrocortisone intravenously,how many mls should you give?(stock =hydrocortisone 100mg in 2mls)arrow_forward
- If someone was working with a 50 MBq F-18 source, what would be the internal and external dose consequences?arrow_forwardWe will be starting a group project next week where you and your group will research and ultimately present on a current research article related to the biology of a pathogen that infects humans. The article could be about the pathogen itself, the disease process related to the pathogen, the immune response to the pathogen, vaccines or treatments that affect the pathogen, or other biology-related study about the pathogen. I recommend that you choose a pathogen that is currently interesting to researchers, so that you will be able to find plenty of articles about it. Avoid choosing a historical disease that no longer circulates. List 3 possible pathogens or diseases that you might want to do for your group project.arrow_forwardnot use ai pleasearrow_forward
- DNK dagi nukleotidlar va undan sintezlangan oqsildagi peptid boglar farqi 901 taga teng bo'lib undagi A jami H boglardan 6,5 marta kam bo'lsa DNK dagi jami H bog‘lar sonini topingarrow_forwardOne of the ways for a cell to generate ATP is through the oxidative phosphorylation. In oxidative phosphorylation 3 ATP are produced from every one NADH molecule. In respiration, every glucose molecule produces 10 NADH molecules. If a cell is growing on 5 glucose molecules, how much ATP can be produced using oxidative phosphorylation/aerobic respiration?arrow_forwardIf a cell is growing on 5 glucose molecules, how much ATP can be produced using oxidative phosphorylation/aerobic respiration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY