ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260406092
Author: HARTWELL, Leland, HOOD, Leroy, Goldberg, Michael
Publisher: Mcgraw-hill Education/stony Brook University
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 32P
The yeast gene encoding a protein found in the mitotic spindle was cloned by a laboratory studying mitosis. The gene encodes a protein of 477 amino acids.
a. | What is the minimum length in |
b. | A partial sequence of one DNA strand in an exon containing the middle of the coding region of the yeast gene is given here. What is the sequence of nucleotides of the mRNA in this region of the gene? Show the 5′and 3′ directionality of your strand. 5′ GTAAGTTAACTTTCGACTAGTCCAGGGT 3′ |
c. | What is the sequence of amino acids in this part of the yeast mitotic spindle protein? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
not use ai please
DNK dagi nukleotidlar va undan sintezlangan oqsildagi peptid boglar farqi 901 taga teng bo'lib undagi A jami H boglardan 6,5 marta kam bo'lsa DNK dagi jami H bog‘lar sonini toping
One of the ways for a cell to generate ATP is through the oxidative phosphorylation. In oxidative phosphorylation 3 ATP are produced from every one NADH molecule. In respiration, every glucose molecule produces 10 NADH molecules. If a cell is growing on 5 glucose molecules, how much ATP can be produced using oxidative phosphorylation/aerobic respiration?
Chapter 8 Solutions
ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Answer in step by step with explanation. Don't use Ai and chatgpt.arrow_forwardIdentify the indicated cavity (Fucus). a. antheridia b. conceptacel c. receptacle d. oogonium e. none of thesearrow_forwardIdentify the indicated structure (Saprolegnia). a. antheridium O b. oospore c.sperm d. auxospore e. tetraspore Of. zygosporearrow_forward
- Using information from the primary literature (several references have been provided as a starting point below) please answer the following question: Based on your review of the literature on rewilding, what are the major scientific pros and cons for rewilding? Please note that the focus of this assignment are the (biological) scientific issues associated with rewilding. As will be discussed in class, there are a number of non-scientific issues involved or implicated in rewilding, all ultimately affecting the public acceptability of rewilding. Although these issues are important – indeed, critical – in this assignment you should focus on the biological science issues and questions. Details: You must enumerate at least two pros and at least two cons. Your answer should be no more than 500 well-chosen words, excluding references. Think carefully about how best to organize and structure your answer. Aim for high information density: say a lot, but say it succinctly. Recall Nietzche’s…arrow_forwardUsing information from the primary literature (several references have been provided as a starting point below) please answer the following question: Based on your review of the literature on rewilding, what are the major scientific pros and cons for rewilding? Please note that the focus of this assignment are the (biological) scientific issues associated with rewilding. As will be discussed in class, there are a number of non-scientific issues involved or implicated in rewilding, all ultimately affecting the public acceptability of rewilding. Although these issues are important – indeed, critical – in this assignment you should focus on the biological science issues and questions. Details: You must enumerate at least two pros and at least two cons. Your answer should be no more than 500 well-chosen words, excluding references. Think carefully about how best to organize and structure your answer. Aim for high information density: say a lot, but say it succinctly. Recall Nietzche’s…arrow_forwardNow draw a rough sketch of what the control data might look like if in addition to the specific binding, there was also a considerable amount of nonspecific binding (again using a normal dose/response curve) (do % total bound ligand vs concentration)arrow_forward
- What are functions of cuboidal cells in the kidney? Select all that apply. Concentration of gases Dilution of chemicals Secretion of molecules Nutrition to tissues Support of tissues Absorption of moleculesarrow_forwardquestion1 In plants, epithelial tissue is only found as the outermost cell layer and acts as a barrier. In humans, epithelial tissue is found inside the body as well as on the surface. What function(s) does/do epithelial tissue carry out in humans? Select all that apply. Waste storage Filtration Oxygen transport Protection Diffusion Osmosis Absorptionarrow_forwardWhat words best describes this organism? a. Unicellular/nonmotile Ob. unicellular/motile c. colonial/nonmotile d. colonial/motile e. multicelluar O f. siphonous g. none of thesearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxCase Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY