ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260406092
Author: HARTWELL, Leland, HOOD, Leroy, Goldberg, Michael
Publisher: Mcgraw-hill Education/stony Brook University
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 15P
Charles Yanofsky isolated many different trpA- mutants (Fig. 8.3).
| a. | Explain how he could identify Trp- auxotrophs of E. coli using replica plating (recall Fig. 7.6). |
| b. | Assuming that the role of TrpA enzyme in the tryptophan biosynthesis pathway was known, explain how Yanofsky could have identified trpA- mutants among his trp- auxotrophs. (Hint: Recall Beadle and Tatum’s one gene, one enzyme experiments in Chapter 7.) |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A classic way to isolate thymidylate synthase-negative mutants of
bacteria is to treat a growing culture with thymidine and trimetho-
prim. Most of the cells are killed, and the survivors are greatly
enriched in thymidylate synthase-negative mutants.
(a) What phenotype would allow you to identify these mutants?
(b) What is the biochemical rationale for the selection? (That is, why
are the mutants not killed under these conditions?)
(c) How would the procedure need to be modified to select mam-
malian cell mutants defective in thymidylate synthase?
A classic way to isolate thymidylate synthase-negative mutants of bacteria
is to treat a growing culture with thymidine and trimethoprim. Most of
the cells are killed, and the survivors are greatly enriched in thymidylate
synthase-negative mutants.
(a) What phenotype would allow you to identify these mutants?
(b) What is the biochemical rationale for the selection? (That is, why are the
mutants not killed under these conditions?)
(c) How would the procedure need to be modified to select mammalian cell
mutants defective in thymidylate synthase?
A classic way to isolate thymidylate synthase–negative mutants of bacteriais to treat a growing culture with thymidine and trimethoprim. Most ofthe cells are killed, and the survivors are greatly enriched in thymidylatesynthase–negative mutants.(a) What phenotype would allow you to identify these mutants?(b) What is the biochemical rationale for the selection? (That is, why are themutants not killed under these conditions?)(c) How would the procedure need to be modified to select mammalian cellmutants defective in thymidylate synthase?
Chapter 8 Solutions
ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A number of auxotrophic mutant strains were isolated from wild-type haploid Neurospora crassa. These strains responded to the addition of certain nutritional supplements to minimal culture medium either by growth (+) or no growth (0) The data from this experiment are presented in the table below. Diagram a biochemical pathway, complete with positions of intermediates, that is consistent with the data. Indicate where in the pathway each mutant strain is blocked.arrow_forwardMutants of Neurospora crassa that lack carbamoyl phosphate synthetase I (CPS I) require arginine in the medium in order to grow, whereas mutants that lack carbamoyl-phosphate synthetase II (CPS II) require a pyrimidine, such as uracil. A priori, one would expect the active CPS II in the arginine mutants to provide sufficient carbamoyl phosphate for arginine synthesis, and the active CPS I in the pyrimidine mutants to “feed” the pyrimidine pathway. Explain these observations.arrow_forwardFor E. coli strains with the lac genotypes show below, use a plus sign (+) to indicate the synthesis of β-galactosidase and permease and a minus sign (–) to indicate no synthesis of the proteins.arrow_forward
- A bloactlve hexapeptide was cleaved by trypsln from a larger proteln. The peptlde was sequenced by treatment with varlOus reagents and enzymes. The results are as follows: a) Treatment with cyan0gen bromlde gave a tetrapeptlde of compositlon asp, trp, cys and met. b) Treatment with chymotrypsln gave a tripeptlde of compositlon asp, trp and cys, a dipeptlde wlth the same C-term and an amlno acld. c) Treatment with streptococcal protease gave a dipeptlde and a tetrapeptlde. The composltion of the peptlde Is lys, trp, asp, cys and met 1. What Is the sequence of the hexapeptlde? 2. What is the pl of thls peptlde?arrow_forwardDescribe what each of the 12 bands on your Western blot should have been. Remember, the 12 bands will be 4 conditions x 3 proteins (phospho-S6, phospho-AMPK, tubulin). Please describe the relative density of each band compared to the control (for example, how dense will phospho-S6 be in each of the three experimental conditions compared to the control condition?). For each band, provide a well-reasoned rationale for your anticipated result. Give the reason why cell signaling would produce each result in each condition.arrow_forwardMutation analysis of GCK gene in patients with diabetes revealed a c.114 T→A (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) Which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) Draw the expected agarose gel result of a homozygous wild type, homozygous mutant and heterozygote individual after restriction enzyme analysis. ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGCATGGCAGCTCTAATGACAGGATGGTCACCCCTGCTGAGGCC ACTCCTGGTCACCATGACAACCACAGGCCCTCTCAGTATCACAGTAAGCCCTGGCAGGAGAATCCCCCACTCCAC ACCTGGCTGGAGCACGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGCAGGCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Restriction enzyme Recognition seguence www wwwtw ww Nar I GG/CGCC…arrow_forward
- Various antimicrobial drugs to treat microbial infection have diverse mechanism of action. Consider the following antimicrobial drugs: A. Seconeolitsine, known as DNA topoisomerase I inhibitor in bacteria. (i) Explain briefly how inhibiting DNA topoisomerase I is a good mechanism of action for an antibiotic, include possible molecular machineries being targeted. (ii) What would be an appropriate response if seconeolitsine works well by stating the state of supercoiling in bacteria. (iii) To prove your answer (ii), you test the condition of bacterial DNA by running gel electrophoresis, one has been treated with seconeolitsine (+ sample) and the other one is not (- sample). Explain the position of each + sample and – sample band on the gel in reference to the point of origin (where you load your samples) or how far each DNA sample travel across agarose gel. (iv) Explain why you would expect answer (iii) for each + sample and – sample. B.…arrow_forwardIn a mixed heteropolymer experiment, messages were createdwith either 4/5C:1/5A or 4/5A:1/5C. These messages yielded proteinswith the amino acid compositions shown in the followingtable. Using these data, predict the most specific coding compositionfor each amino acid.4/5C:1/5A 4/5A:1/5CPro 63.0% Pro 3.5%His 13.0% His 3.0%Thr 16.0% Thr 16.6%Glu 3.0% Glu 13.0%Asp 3.0% Asp 13.0%Lys 0.5% Lys 50.0% 98.5% 99.1%arrow_forwardThere are three names that often get used when discussing the Lowry assay. Those names are: Lowry, Folin-Ciocalteu, and Biuret. Are those names interchangeable when discussing the assay or do those names describe the same thing(s)? Significant differences? What is the relationship between those names?arrow_forward
- Mutation analysis of GCK gene in patients with diabetes revealed a c.114 T A (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) Which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) Draw the expected agarose gel result of a homozygous wild type, homozygous mutant and heterozygote individual after restriction enzyme analysis. ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGCATGGCAGCTCTAATGACAGGATGGTCACCCCTGC TGAGGCCACTCCTGGTCACCATGACAACCACAGGCCCTCTCAGTATCACAGTAAGCCCTGGCAGGAG AATCCCCCACTCCACACCTGGCTGGAGCACGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGCAG GCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Restriction enzyme Recognition seguence Nar I GG/CGCC Dde I c/TNAG…arrow_forwardFor the lac genotypes of Escherichia coli shown in the following Table 1, predict the expression of beta-galactosidase (Z) and permease (Y) is inducible or noninducible or constitutive. Explain your answer. Table 1 Genotype I-P+O+Z+Y+ (i) (ii) I+P+OCZ+Y+ (iii) ISP+O+Z+Y+ (iv) I+P+O+Z+Y-//I+P-O+Z+Y+ (v) ISP+OcZ+Y+//I-P+O+Z+Y- Condition No lactose No lactose lactose lactose No lactosearrow_forwardWhat is the attached enzyme in this assay and its corresponding substrate? A. Horseradish peroxidase and OPD (o-phenylenediamine dihydrochloride) B. Horseradish peroxidase and PNPP (p-Nitrophenyl Phosphate, Disodium Salt) C. Horseradish peroxidase and TMB (3,3',5,5'-tetramethylbenzidine) D. Horseradish peroxidase and ABTS (2,2'-azinobis-3-ethylbenzothiazoleine-6- sulfonic acid)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY