GENETICS:FROM GENES TO GENOMES(LL)-PKG
GENETICS:FROM GENES TO GENOMES(LL)-PKG
6th Edition
ISBN: 9781260377033
Author: HARTWELL
Publisher: MCG
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 8, Problem 33P

The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA.

5CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3

3 GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCG 5

a. Which strand is the template strand? In which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene?
b. What is the sequence of the nucleotides in the processed mRNA molecule for this gene? Indicate the 5′ and 3′ polarity of this mRNA.
c. A single base mutation in the gene results in synthesis of the peptide Met Tyr Thr. What is the sequence of nucleotides making up the mRNA produced by this mutant gene?
Blurred answer
Students have asked these similar questions
Case Study—Ella Ella has a family history of diabetes. She wants to follow a healthful eating pattern that can lower her risk for developing this condition. Her dietitian recommends a goal of 450 to 600 kcal per meal and advises Ella to follow the Acceptable Macronutrient Distribution Range (AMDR) for carbohydrates and the Dietary Guidelines for Americans 2015-2020, which recommend limiting added sugar. She also recommends that Ella choose whole grains rather than processed grains. Ella decides to pack a lunch to take to work every day. This morning she’s making a sandwich for her lunch.   Categories of Sandwich Options (Top of the screen) Breads Spreads Cheeses Vegetables Proteins Specific food items to select White Bread 6-inches Honey Mustard Provolone LettuceTomatoBell Peppers Turkey Part A - Reading Nutrition Facts Panels for Total Kilocalories How many total kilocalories are in Ella’s sandwich? _______ kcal ?   Part B - Reading Nutrition Facts Panels for…
Case Study—Ella Ella has a family history of diabetes. She wants to follow a healthful eating pattern that can lower her risk for developing this condition. Her dietitian recommends a goal of 450 to 600 kcal per meal and advises Ella to follow the Acceptable Macronutrient Distribution Range (AMDR) for carbohydrates and the Dietary Guidelines for Americans 2015-2020, which recommend limiting added sugar. She also recommends that Ella choose whole grains rather than processed grains. Ella decides to pack a lunch to take to work every day. This morning she’s making a sandwich for her lunch.   Categories of Sandwich Options (Top of the screen) Breads Spreads Cheeses Vegetables Proteins Specific food items to select White Bread 6-inches Honey Mustard Provolone LettuceTomatoBell Peppers Turkey Part A - Reading Nutrition Facts Panels for Total Kilocalories   How many total kilocalories are in Ella’s sandwich exactl  ______kcal ?   Part B - Reading Nutrition Facts Panels for…
In humans, red-green color blindness is recessive and X-linked, whereas albinism is recessive and autosomal.  What types of children can be produced as the result of marriage between two homozygous parents, a normal-vision albino woman and a color-blind, normal male?

Chapter 8 Solutions

GENETICS:FROM GENES TO GENOMES(LL)-PKG

Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY