GENETICS:FROM GENES TO GENOMES(LL)-PKG
6th Edition
ISBN: 9781260377033
Author: HARTWELL
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 7P
The following diagram describes the mRNA sequence of part of the A gene and the beginning of the B gene of phage ϕX174. In this phage, some genes are read in overlapping reading frames. For example, the code for the A gene is used for part of the B gene, but the reading frame is displaced by one base. Shown here is the single mRNA with the codons for proteins A and B indicated.
aa# 5 6 7 8 9 10 11 12 13 14 15 16
A AlaLysGluTrpAsnAsnSerLeuLysThrLysLeu
mRNA GCUAAAGAAUGGAACAACUCACUAAAAACCAAGCUG
B MetGluGlnLeuThrLysAsnGlnAla
aa# 1 2 3 4 5 6 7 8 9
Given the following amino acid (aa) changes, indicate the base change that occurred in the mRNA and the consequences for the other protein sequence.
a. | Asn at position 10 in protein A is changed to Tyr. |
b. | Leu at position 12 in protein A is changed to Pro. |
c. | Gln at position 8 in protein B is changed to Leu. |
d. | The occurrence of overlapping reading frames is very rare in nature. When it does occur, the extent of the overlap is not very long. Why do you think this is the case? |
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Use the figure below. Bob and Nancy have the same income and total utility..
willingness to pay for an insurance premium will be lower than
because they are.
risk-
averse.
Total
utility
Current
utility
Bob's utility
Nancy's utility
0000
Bob; Nancy; less
Nancy; Bob; less
Nancy; Bob; more
Bob; Nancy; more
Current
Income
income
Consider the figure below. Suppose the true price of a health care service is P1. Suppose further that the individual has obtained insurance that has a fixed copayment for this
particular service. The copayment is represented by price P2. represents the quantity of the service the individual would consume without insurance.
quantity of the service the individual would consume with the insurance.
Health Care Service
represents the
P.
P₂
a
Q1;Q2
Q2; Q3
Q1; Q3
Q3; Q1
Q2; Q1
फ
f
Q
८
g
d
h
Q3\D
7Q
00000
The table shows the utility Jordan receives at various income levels, but they do not know what their income will be next year. There is a 15% chance their income will be
$25,000, a 20% chance their income will be $35,000, and a 65% chance their income will be $45,000. We know that Jordan is
Income
$25,000
Utility
2,800
30,000
3,200
35,000
3,500
40,000
3,700
45,000
3,800
☐ none of the above
0 000
risk taker (lover) because their marginal utility of income is increasing
risk neutral because their marginal utility of income is constant
risk averse because their marginal utility of income is decreasing
risk neutral because their marginal utility of income is decreasing
Chapter 8 Solutions
GENETICS:FROM GENES TO GENOMES(LL)-PKG
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- OOOO a d+e d a+b+c Consider the figure below. Suppose the true price of a health care service is P1. Suppose further that the individual has obtained insurance that has a fixed copayment for this particular service. The copayment is represented by price P2. The social loss from moral hazard if the individual has copayment P2 is represented graphically by the area(s): Health Care Service P. a No 4 ८ e g Q2 Q3 Darrow_forwardOOO O The table shows the utility Jordan receives at various income levels, but they do not know what their income will be next year. There is a 15% chance their income will be $25,000, a 20% chance their income will be $35,000, and a 65% chance their income will be $45,000. We know that Jordan's expected income is. Their utility from their expected income is_ Income $25,000 Utility 2,800 30,000 3,200 35,000 3,500 40,000 3,700 45,000 3,800 $45,000; 3,800 $40,000; 3,700 $25,000; 2,800 $35,000; 3,500 $30,000; 3,200arrow_forwardQuestion 1 Classify the Bird Mark 7; how is it: Powered Triggered Cycled Classify brid mark 7 Powered: By gas (oxygen) Triggered: Negative Pressure, caused by the patient’s inspiratory effort Cycled: The machine stops delivering gas and allows for exhalationarrow_forward
- Hypothetical "pedigree" for Sickle Cellarrow_forwardwould this be considered a novel protein and if not how can I fix it so it is and can you draw the corrections pleasearrow_forwardIn as much detail as possible, hand draw a schematic diagram of the hypothalamic-pituitary- gonad (HPG) axis in the human male. Be sure to include all the relevant structures and hormones. You must define all abbreviations the first time you use them. Please include (and explain) the feedback loops.arrow_forward
- A negligence action was brought by a mother against a hospital on behalf of her minor daughter. It alleged that when the mother was 13 years of age, the hospital negligently transfused her with Rh-positive blood. The mother's Rh-negative blood was incompatible with and sensitized by the Rh-positive blood. The mother discovered her condition 8 years later during a routine blood screening ordered by her healthcare provider in the course of prenatal care. The resulting sensitization of the mother's blood allegedly caused damage to the fetus, resulting in physical defects and premature birth. Did a patient relationship with the transfusing hospital exist?arrow_forward18. Watch this short youtube video about SARS CoV-2 replication. SARS-CoV-2 Life Cycle (Summer 2020) - YouTube.19. What is the name of the receptor that SARS CoV-2 uses to enter cells? Which human cells express this receptor? 20. Name a few of the proteins that the SARS CoV-2 mRNA codes for. 21. What is the role of the golgi apparatus related to SARS CoV-2arrow_forwardState the five functions of Globular Proteins, and give an example of a protein for each function.arrow_forward
- Diagram of check cell under low power and high powerarrow_forwarda couple in which the father has the a blood type and the mother has the o blood type produce an offspring with the o blood type, how does this happen? how could two functionally O parents produce an offspring that has the a blood type?arrow_forwardWhat is the opening indicated by the pointer? (leaf x.s.) stomate guard cell lenticel intercellular space none of thesearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305967359/9781305967359_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY