The way by which DNA-binding proteins make sequence-specific contacts to a double-stranded DNA molecule without breaking hydrogen bonds. Introduction: DNA-binding proteins are the proteins that specifically bind to the strands of DNA, which includes enzymes (nucleases, polymerases, and ligases) involved in the DNA replication , transcription factors for mRNA synthesis, and translation factors for protein synthesis and histone molecules for chromosome packaging. So, these proteins are present in both prokaryotes and eukaryotes.

Question

Want to see the full answer?

Answer 1

Question

Chapter 8, Problem 2Q

Summary Introduction

To explain: The way by which DNA-binding proteins make sequence-specific contacts to a double-stranded DNA molecule without breaking hydrogen bonds.

Introduction: DNA-binding proteins are the proteins that specifically bind to the strands of DNA, which includes enzymes (nucleases, polymerases, and ligases) involved in the DNA replication, transcription factors for mRNA synthesis, and translation factors for protein synthesis and histone molecules for chromosome packaging. So, these proteins are present in both prokaryotes and eukaryotes.

Summary Introduction

To indicate: The parts of base pairs that could form such non-covalent interactions.

Introduction: DNA-binding proteins have affinity for single- or double-stranded DNA, as they have DNA-binding domains. They bind non-covalently to interactive surfaces of sequence specific base pairs in the major groove. The chains in the major groove provide ionic charges and domains for binding of side chains of amino acids in proteins.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

What is amplification bias?

Answer 2

Question

Chapter 8, Problem 2Q

Summary Introduction

To explain: The way by which DNA-binding proteins make sequence-specific contacts to a double-stranded DNA molecule without breaking hydrogen bonds.

Introduction: DNA-binding proteins are the proteins that specifically bind to the strands of DNA, which includes enzymes (nucleases, polymerases, and ligases) involved in the DNA replication, transcription factors for mRNA synthesis, and translation factors for protein synthesis and histone molecules for chromosome packaging. So, these proteins are present in both prokaryotes and eukaryotes.

Summary Introduction

To indicate: The parts of base pairs that could form such non-covalent interactions.

Introduction: DNA-binding proteins have affinity for single- or double-stranded DNA, as they have DNA-binding domains. They bind non-covalently to interactive surfaces of sequence specific base pairs in the major groove. The chains in the major groove provide ionic charges and domains for binding of side chains of amino acids in proteins.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 8, Problem 2Q

Summary Introduction

To explain: The way by which DNA-binding proteins make sequence-specific contacts to a double-stranded DNA molecule without breaking hydrogen bonds.

Introduction: DNA-binding proteins are the proteins that specifically bind to the strands of DNA, which includes enzymes (nucleases, polymerases, and ligases) involved in the DNA replication, transcription factors for mRNA synthesis, and translation factors for protein synthesis and histone molecules for chromosome packaging. So, these proteins are present in both prokaryotes and eukaryotes.

Summary Introduction

To indicate: The parts of base pairs that could form such non-covalent interactions.

Introduction: DNA-binding proteins have affinity for single- or double-stranded DNA, as they have DNA-binding domains. They bind non-covalently to interactive surfaces of sequence specific base pairs in the major groove. The chains in the major groove provide ionic charges and domains for binding of side chains of amino acids in proteins.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 8, Problem 2Q

Summary Introduction

To explain: The way by which DNA-binding proteins make sequence-specific contacts to a double-stranded DNA molecule without breaking hydrogen bonds.

Introduction: DNA-binding proteins are the proteins that specifically bind to the strands of DNA, which includes enzymes (nucleases, polymerases, and ligases) involved in the DNA replication, transcription factors for mRNA synthesis, and translation factors for protein synthesis and histone molecules for chromosome packaging. So, these proteins are present in both prokaryotes and eukaryotes.

Summary Introduction

To indicate: The parts of base pairs that could form such non-covalent interactions.

Introduction: DNA-binding proteins have affinity for single- or double-stranded DNA, as they have DNA-binding domains. They bind non-covalently to interactive surfaces of sequence specific base pairs in the major groove. The chains in the major groove provide ionic charges and domains for binding of side chains of amino acids in proteins.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 8, Problem 2Q

Summary Introduction

To explain: The way by which DNA-binding proteins make sequence-specific contacts to a double-stranded DNA molecule without breaking hydrogen bonds.

Introduction: DNA-binding proteins are the proteins that specifically bind to the strands of DNA, which includes enzymes (nucleases, polymerases, and ligases) involved in the DNA replication, transcription factors for mRNA synthesis, and translation factors for protein synthesis and histone molecules for chromosome packaging. So, these proteins are present in both prokaryotes and eukaryotes.

Summary Introduction

To indicate: The parts of base pairs that could form such non-covalent interactions.

Introduction: DNA-binding proteins have affinity for single- or double-stranded DNA, as they have DNA-binding domains. They bind non-covalently to interactive surfaces of sequence specific base pairs in the major groove. The chains in the major groove provide ionic charges and domains for binding of side chains of amino acids in proteins.

Answer 6

Chapter 8, Problem 2Q

Summary Introduction

To explain: The way by which DNA-binding proteins make sequence-specific contacts to a double-stranded DNA molecule without breaking hydrogen bonds.

Introduction: DNA-binding proteins are the proteins that specifically bind to the strands of DNA, which includes enzymes (nucleases, polymerases, and ligases) involved in the DNA replication, transcription factors for mRNA synthesis, and translation factors for protein synthesis and histone molecules for chromosome packaging. So, these proteins are present in both prokaryotes and eukaryotes.

Answer 7

Chapter 8, Problem 2Q

Summary Introduction

To explain: The way by which DNA-binding proteins make sequence-specific contacts to a double-stranded DNA molecule without breaking hydrogen bonds.

Introduction: DNA-binding proteins are the proteins that specifically bind to the strands of DNA, which includes enzymes (nucleases, polymerases, and ligases) involved in the DNA replication, transcription factors for mRNA synthesis, and translation factors for protein synthesis and histone molecules for chromosome packaging. So, these proteins are present in both prokaryotes and eukaryotes.

Answer 8

Summary Introduction

To indicate: The parts of base pairs that could form such non-covalent interactions.

Introduction: DNA-binding proteins have affinity for single- or double-stranded DNA, as they have DNA-binding domains. They bind non-covalently to interactive surfaces of sequence specific base pairs in the major groove. The chains in the major groove provide ionic charges and domains for binding of side chains of amino acids in proteins.

Answer 9

Summary Introduction

To indicate: The parts of base pairs that could form such non-covalent interactions.

Introduction: DNA-binding proteins have affinity for single- or double-stranded DNA, as they have DNA-binding domains. They bind non-covalently to interactive surfaces of sequence specific base pairs in the major groove. The chains in the major groove provide ionic charges and domains for binding of side chains of amino acids in proteins.

Answer 10

Expert Solution & Answer

Answer 11

Expert Solution & Answer

Answer 12

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 13

Ch. 8 - Prob. 1Q Ch. 8 - Prob. 2Q Ch. 8 - Prob. 3Q Ch. 8 - Prob. 4Q Ch. 8 - Prob. 5Q Ch. 8 - Prob. 6Q Ch. 8 - Prob. 7Q Ch. 8 - Prob. 8Q Ch. 8 - Prob. 9Q Ch. 8 - Prob. 10Q

Concept explainers

Videos

Want to see the full answer?

Chapter 8 Solutions