Microbiology: An Introduction
12th Edition
ISBN: 9780321929150
Author: Gerard J. Tortora, Berdell R. Funke, Christine L. Case
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 2CAE
HIV, the virus that causes AIDS, was isolated from three individuals, and the amino acid sequences for the viral coat were determined. Of the amino acid sequences shown below, which two of the viruses are most closely related? How can these amino acid sequences be used to identify the source of a virus?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Researchers have been determining the nucleotide sequences of variant forms of SARS-CoV-2, looking for versions of the virus that might be more easily transmitted between humans or that might be more deadly.
(a) For example, one mutation in a viral gene changed a GAU codon to a GGU codon. How does this change affect the sequence of the polypeptide encoded by that gene?
(b) In another variant form of the virus, a gene is missing six consecutive nucleotides. How would this change affect the sequence of the polypeptide encoded by that gene?
(c) In another coronavirus variant, the spike protein (the prominent protein on the surface of the virus) contains a histidine residue where an aspartate (aspartic acid) residue should be. Describe a point mutation in the coronavirus genome that could have caused this change in the spike protein.
A particular animal virus requires the use of DNA polymerase from its host, since it does not possess its own DNA polymerase enzyme. Which of the following assumptions in A-D would likely be
correct regarding this virus?
A) O This virus could not be a retrovirus type.
B) OIt could be a (-) ss RNA virus.
C) O It could be a (+) ss RNA virus.
D) O The vVirus life cycle very likely includes going to the host cell nucleus.
E) O All ofA-D are correct assumptions.
The base composition of an RNA virus was analyzed and found to be 14.1% A, 14.0% U, 36.2% G, and 35.7% C. Would you conclude that the viral genetic material is single-stranded RNA or doublestranded RNA?
Chapter 8 Solutions
Microbiology: An Introduction
Ch. 8 - Briefly describe the components of DNA, and...Ch. 8 - DRAW IT Identify and mark each of the following on...Ch. 8 - Match the following examples of mutagens. Column A...Ch. 8 - The following is a code for a strand of DNA. a....Ch. 8 - Identify when (before transcription, after...Ch. 8 - Which sequence is the best target for damage by UV...Ch. 8 - You are provided with cultures with the following...Ch. 8 - Why are mutation and recombination important in...Ch. 8 - NAME IT Normally a commensal in the human...Ch. 8 - Match the following terms to the definitions in...
Ch. 8 - Match the following terms to the definitions in...Ch. 8 - Feedback inhibition differs from repression...Ch. 8 - Bacteria can acquire antibiotic resistance by all...Ch. 8 - Suppose you inoculate three flasks of minimal...Ch. 8 - Plasmids differ from transposons in that plasmids...Ch. 8 - Mechanism by which the presence of glucose...Ch. 8 - The mechanism by which lactose controls the lac...Ch. 8 - Two offspring cells are most likely to inherit...Ch. 8 - Which of the following is not a method of...Ch. 8 - Nucleoside analogs and ionizing radiation are used...Ch. 8 - Replication of the E. coli chromosome takes 40 to...Ch. 8 - Pseudomonas has a plasmid containing the mer...Ch. 8 - Ciprofloxacin, erythromycin, and acyclovir are...Ch. 8 - HIV, the virus that causes AIDS, was isolated from...Ch. 8 - Human herpesvirus-8 (HHV-8) is common in parts of...
Additional Science Textbook Solutions
Find more solutions based on key concepts
More than one choice may apply. Using the terms listed below, fill in the blank with the proper term. anterior ...
Essentials of Human Anatomy & Physiology (11th Edition)
Why do scientists think that all forms of life on earth have a common origin?
Genetics: From Genes to Genomes, 5th edition
Describe the role and impact of microbes on the earth.
Microbiology Fundamentals: A Clinical Approach - Standalone book
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (5th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Are they true or false? a)If someone reads an absorbance of 0,25 at 260 nm, the concentration of the dsDNA is 25 ug/ml. b)If someone reads an absorbance of 0,25 at 260 nm, the concentration of the dsDNA is 25 ug/ml c)The copy number refers to the number of molecules of an individual plasmid that are normally found in a single bacterial cell. d)The amount of mRNA level can be determined via competitor RT-PCR in which two different sized products can be obtained, one of which is a known standard.arrow_forwardTo test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…arrow_forwardHeinz Shuster collected the following data on the base composition of ribgrass mosaic virus (H. Shuster, in The Nucleic Acids: Chemistry andBiology, vol. 3, E. Chargaff and J. N. Davidson, Eds. New York: Academic Press, 1955). On the basis of this information, is the hereditary information of the ribgrass mosaic virus RNA or DNA? Is it likely to be single stranded or double stranded?arrow_forward
- Chemical composition analysis of a viral genome showed 22.1% A, 27.9% C, 27.9% G, and 22.1% U. Based on this, the viral genome is most likely made of: a) single-stranded (ss) DNA b) double-stranded (ds) DNA c) SSRNA d) dsRNA e) plasmid DNAarrow_forwardThere have been recent outbreaks of dog flu in the US. Why doesn't this virus infect humans? A) The virus can replicate in cells of all species but can only egress from dog cells. B) The genetic code of the virus is the same as that in dog cells but is different from other organisms. C) The virus can only attach to dog cells. D) The virus can enter cells of all species but can only replicate in dog cells.arrow_forwardWhich of the following are the functions of reverse transcriptase in retroviruses? i) it hydrolyzes the host cell's DNA ii) it uses viral RNA as a template for DNA synthesis iii) it converts host cell RNA into viral DNA iv) it translates viral RNA into proteins v) It uses viral RNA as a template for making complementary RNA strand vi) It degrades RNA from DNA-RNA hybrid Oi, iv and v O ii, iv, v and vi ii and iii ii and viarrow_forward
- As stated in the text, bacteriophages have been discovered with the following base substitutions in their DNA: (a) dUMP completely substituting for 'TMP (b) 5-hydroxymethyl-dUMP completely substituting for d'TMP (c) 5-methyl-dCMP completely substituting for dCMP For any one of these cases, formulate a set of virus-coded enzyme activities that could lead to the observed substitution. Write a balanced equation for each reaction you propose.arrow_forwardYou have been tasked with designing a new computer algorithm to identify protein-coding genes in bacterial genomes.a) Name 3 specific criteria/patterns you will use to define whether a given sequence could contain a full-length protein-coding gene, and briefly justify your choices.b) Do you think your algorithm will work well to detect proteins encoded by the archaean Sulfolobus acidocaldarius? Why or why not?c) Do you think your algorithm will work well to detect proteins encoded in the eukaryotic yeast Saccharomyces cerevisiae? Why or why not?arrow_forwardWhat is the function of reverse transcriptase in retroviruses? a) It converts viral RNA into double-stranded DNA Ob) It uses viral RNA as a template for making complementary RNA strands Oc) It translates viral RNA into proteins d) It uses viral DNA as a template for RNA synthesisarrow_forward
- At which stage of viral infection did these mutations most likely occur? a.) Attachment b.) Entry c.) Uncoating d.) Protein syntheis e.) Genome replicaton f.) Assembly g.) Exitarrow_forwardAnswer the following regarding the varicella-zoster virus: a) the biology of the virus ( type: DNA/RNA type: single or double stranded) b) how it replicates c) life cycle of the virus (binding, fusion, reverse transcription, integration, replication, and assembly)arrow_forward* 00 65 The genomes of DNA viruses can be relatively small (~5,000 nucleotides) but can also be quite large (greater than 2 million nucleotides). In contrast, the largest known genome of any RNA virus is only ~35,000 nucleotides but most are < 10,000 nucleotides. What is the primary reason to explain why the genome sizes of RNA viruses are so constrained in size relative to DNA viruses? Edit View Insert Format Tools Table A xd0 Paragraph v U AV B. へzl Because the mutation rate in viruses are abudnent, the bigger the virion the more likely it is for a bigger virus to have more mutation. Thus, rna viruses are usually small in size. 31 8. EE O 8: & 09 6arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license