Microbiology: An Introduction
11th Edition
ISBN: 9780321733603
Author: Gerard J. Tortora, Berdell R. Funke, Christine L. Case
Publisher: Benjamin Cummings
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 2CAE
HIV, the virus that causes AIDS, was isolated from three individuals, and the amino acid sequences for the viral coat were determined. Of the amino acid sequences shown below, which two of the viruses are most closely related? How can these amino acid sequences be used to identify the source of a virus?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Viruses are made up of the same biomolecules as cellular organisms (DNA, RNA, proteins, lipids, etc.). They infect cells and replicate themselves using resources from the host cells. Scientists discovered a previously unknown strain of virus in the tropical Pacific Ocean and it can infect higher-order eukaryotes. Initial analysis revealed that the virus is mainly composed of nucleic acids, proteins, and lipids. Chemical analysis after complete hydrolysis revealed the following building blocks (by weight):
Chemical components
Nucleosides
Amino acids
Lipids, phosphates, and carbohydrates
Percentage by weight
20
30
50
Analysis of percentages of nucleosides yielded the following results (by molar ratio):
Nucleosides
A
G
T
C
U
Percentage by mole
19
29
19
29
4
Researchers determined that the lipids found in the virus form a bilayer membrane surrounding the virus, and are obtained from the membrane of the host cell during virus maturation and exit from host cell.
Further…
How many millions of bases are in the genome of
the mimivirus or largest virus known?
Researchers have been determining the nucleotide sequences of variant forms of SARS-CoV-2, looking for versions of the virus that might be more easily transmitted between humans or that might be more deadly.
(a) For example, one mutation in a viral gene changed a GAU codon to a GGU codon. How does this change affect the sequence of the polypeptide encoded by that gene?
(b) In another variant form of the virus, a gene is missing six consecutive nucleotides. How would this change affect the sequence of the polypeptide encoded by that gene?
(c) In another coronavirus variant, the spike protein (the prominent protein on the surface of the virus) contains a histidine residue where an aspartate (aspartic acid) residue should be. Describe a point mutation in the coronavirus genome that could have caused this change in the spike protein.
Chapter 8 Solutions
Microbiology: An Introduction
Ch. 8 - Briefly describe the components of DNA, and...Ch. 8 - DRAW IT Identify and mark each of the following on...Ch. 8 - Match the following examples of mutagens. Column A...Ch. 8 - The following is a code for a strand of DNA. a....Ch. 8 - Prob. 5RCh. 8 - Identify when (before transcription, after...Ch. 8 - Which sequence is the best target for damage by UV...Ch. 8 - You are provided with cultures with the following...Ch. 8 - Why are mutation and recombination important in...Ch. 8 - NAME IT Normally a commensal in the human...
Ch. 8 - Nucleoside analogs and ionizing radiation are used...Ch. 8 - Replication of the E. coli chromosome takes 40 to...Ch. 8 - Pseudomonas has a plasmid containing the mer...Ch. 8 - Match the following terms to the definitions in...Ch. 8 - Match the following terms to the definitions in...Ch. 8 - Feedback inhibition differs from repression...Ch. 8 - Bacteria can acquire antibiotic resistance by all...Ch. 8 - Suppose you inoculate three flasks of minimal...Ch. 8 - Plasmids differ from transposons in that plasmids...Ch. 8 - Mechanism by which the presence of glucose...Ch. 8 - The mechanism by which lactose controls the lac...Ch. 8 - Two offspring cells are most likely to inherit...Ch. 8 - Which of the following is not a method of...Ch. 8 - Ciprofloxacin, erythromycin, and acyclovir are...Ch. 8 - HIV, the virus that causes AIDS, was isolated from...Ch. 8 - Human herpesvirus-8 (HHV-8) is common in parts of...
Additional Science Textbook Solutions
Find more solutions based on key concepts
More than one choice may apply. Using the terms listed below, fill in the blank with the proper term. anterior ...
Essentials of Human Anatomy & Physiology (11th Edition)
Why do scientists think that all forms of life on earth have a common origin?
Genetics: From Genes to Genomes, 5th edition
Describe the role and impact of microbes on the earth.
Microbiology Fundamentals: A Clinical Approach - Standalone book
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (5th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- a variant of the SARS-CoV-2 virus has been found in brazil. this variant contains the mutation K417N, where the amino acid K has been mutated to the amino acid N. K and N refers to the one letter codes of the amino acids. a) state the names of the amino acids K and N. b) state one difference between the properties of these 2 aminoacidsarrow_forwardA particular animal virus requires the use of DNA polymerase from its host, since it does not possess its own DNA polymerase enzyme. Which of the following assumptions in A-D would likely be correct regarding this virus? A) O This virus could not be a retrovirus type. B) OIt could be a (-) ss RNA virus. C) O It could be a (+) ss RNA virus. D) O The vVirus life cycle very likely includes going to the host cell nucleus. E) O All ofA-D are correct assumptions.arrow_forwardTwo theoretical genetic strains of a virus (a-b-c- and a+b+c+) were used to simultaneously infect a culture of host bacteria. Of 10,000 plaques scored, the following genotypes were observed. Determine the genetic map of these three genes on the viral chromosome. Decide whether interference was positive or negative. a+ b+ c+ 4100 a- b+ c- 160 a- b- c- 3990 a+ b- c+ 140 a+ b- c- 740 a- b- c+ 90 a- b+ c+ 670 a+ b+ c- 110arrow_forward
- Assume you isolate a single stranded (+) RNA virus. When you examine the proteins in the virus, you find that it does NOT contain replicase enzymes within its capsid. Which of the following is true? This virus must have a gene that encodes replicase. This virus will not be able to enter a host cell. Its genome cannot be translated (the process of translation) by the host cell ribosomes. A DNA copy of the viral genome has to be made before viral genes are expressed. This virus must lack surface antigens.arrow_forwardAre they true or false? a)If someone reads an absorbance of 0,25 at 260 nm, the concentration of the dsDNA is 25 ug/ml. b)If someone reads an absorbance of 0,25 at 260 nm, the concentration of the dsDNA is 25 ug/ml c)The copy number refers to the number of molecules of an individual plasmid that are normally found in a single bacterial cell. d)The amount of mRNA level can be determined via competitor RT-PCR in which two different sized products can be obtained, one of which is a known standard.arrow_forwardTo test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…arrow_forward
- Name a nucleoside analog. Explain how that nucleoside analog works. Which viruses are effectively treated by that nucleoside analog?arrow_forwardJerome Vinograd found that when circular DNA from apolyoma virus is subjected to cesium chloride gradientcentrifugation, it separates into two distinct bands, oneconsisting of supercoiled DNA and the other of relaxedDNA. Explain how you would identify each band.arrow_forwardThe diagrams below represent nucleic acid genomic material and a finished product after the viral polymerase acted on the genomic material. Name the virus (either family, genus, or particular virus is acceptable) that these diagrams represent. A is B is C is Dis Genomic material Product + sense RNA A 5' VPB -sense RNA 3' VPg 5' -sense RNA 5' cap Derived from infected cell B 3' 5' AAAAA(A) 3 + sense RNA C + sense RNA -sense RNA +sense RNA 5' 3'arrow_forward
- How many protein subunits would be present in a complex icosahedral virus particle with a triangulation (T) number of 8?arrow_forwardWhat type of nucleic acid genome does the human T-cell lymphotropic virus type-1 (HTLV-1) contain as defined by the Baltimore classification system?arrow_forwardAfter a positive strand RNA virus ( Such as Coronaviruses) enters the host cell, the RNA is translated by ribosomes to create proteins associated with the virus (Such as, for example, the surface antigens like E and Spike proteins). How then, would the genetic material itself be replicated to be incorporated into the new viruses?.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license