GENETIC ANALYSIS: AN INTEG. APP. W/MAS
2nd Edition
ISBN: 9781323142790
Author: Sanders
Publisher: Pearson Custom Publishing
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 21P
A mutant strain of Salmonella bacteria carries a mutation of the rho protein that has full activity at
a. Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAs from the mutant strain grown at
b. Are all mRNAs affected by the rho protein mutation in the same way? Why or why not?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A mutant strain of Salmonella bacteria carries a mutation of the rho protein that has fully activity at 37°C but is completely inactivated when the mutant strain is grown at 40°C.
a)Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAs from the mutant strain grown at 37°C and the same spectrum of mRNAs from the strain when grown at 40°C.
b)Are all the mRNAs affected by the rho protein mutation in the same way? Why or why not?
Consider a gene being transcribed at a constant rate k1 and being degraded with first order kinetics with a rate constant of k2. a. Write the chemical reaction for transcriptionb. Derive the instantaneous concentration of the mRNA within the cell. Explicitly list all assumptions.
What are two reasons that a eukaryotic gene (e.g. Green Fluorescent Protein in jellyfish) will not be expressed if it is inserted into a bacterial genome with no alterations?
a. Bacterial genes do not contain introns
b. Bacterial promoters have different consensus sequences than eukaryotic ones
c. Transcription of this gene is affected by the simultaneous processes of transcription and translation
d.
Chapter 8 Solutions
GENETIC ANALYSIS: AN INTEG. APP. W/MAS
Ch. 8 - Prob. 1PCh. 8 - 8.2 In one to two sentences each, describe the...Ch. 8 - 8.3 Answer these questions concerning...Ch. 8 - 8.4 The diagram below shows a DNA duplex. The...Ch. 8 - The following is a portion of an mRNA sequence:...Ch. 8 - Compare and contrast the properties of DNA...Ch. 8 - The DNA sequences shown below are from the...Ch. 8 - Bacterial and eukaryotic gene transcripts can...Ch. 8 - Describe the two types of transcription...Ch. 8 - What is the role of enhancer sequences in...
Ch. 8 - Prob. 11PCh. 8 - Draw a bacterial promoter and label its consensus...Ch. 8 - 13. How do SR proteins help guide premRNA intron...Ch. 8 - Three genes identified in the diagram as A, B and...Ch. 8 - Prob. 15PCh. 8 - 8.16 The segment of the bacterial gene involved in...Ch. 8 - Prob. 17PCh. 8 - Prob. 18PCh. 8 - 8.19 A DNA fragment from the end of the mouse...Ch. 8 - 8.20 Wild-type E. coli grow best at but can grow...Ch. 8 - A mutant strain of Salmonella bacteria carries a...Ch. 8 - 8.22 The human wild-type allele and a certain...Ch. 8 - Prob. 23PCh. 8 - A full-length eukaryotic gene is inserted into a...Ch. 8 - The accompanying illustration shows a portion of a...Ch. 8 - DNA footprint protection (described in Research...Ch. 8 - Suppose you have a 1-kb segment of cloned DNA that...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The figure shows the position of two of these mutations a and b. The nucleotides are altered in these 2 different swo-1 mutant alleles. Use the genetic table to describe any AA changes.Name the type of mutation and describe its effect on swo-1 mRNA and protein for each of the mutations. 3. The swo-1 a mutation (insertion between C and G). 4. The swo-1 b mutation (C-to-T mutation for indicated C). 5. The swo-1 a mutation leads to worms with more body wall muscle, whereas worms with the swo-1 b mutation are not able to move. Based on these phenotypes and the findings from questions 3 and 4, describe the role thewild-type version of this protein plays in muscle function.arrow_forwardDescribes a method known as Western blotting that can be used to detect a polypeptide that is translated from a particular mRNA. In this method, a particular polypeptide or protein is detected by an antibody that specifically recognizes a segment of its amino acid sequence. After the antibody binds to the polypeptide within a gel, a secondary antibody (which is labeled) is used to visualize the polypeptide as a dark band.For example, an antibody that recognizes α-galactosidase A couldbe used to specifically detect the amount of α-galactosidase A proteinon a gel. The enzyme α-galactosidase A is defective in individuals with Fabry disease, which shows an X-linked recessive pattern of inheritance. Amy, Nan, and Pete are siblings, and Pete has Fabry disease. Aileen, Jason, and Jerry are brothers and sister, and Jerry has Fabry disease. Amy, Nan, and Pete are not related to Aileen, Jason, and Jerry. Amy, Nan, and Aileen are concerned that they could be carriers of a defective…arrow_forwardConsider this sequence below: GAG TAC ACG AGT GGA Which of the following options is an example of a non-synonymous point mutation? (remember to translate to mRNA!) A. GAG TAC AAT CGA GTG GA B. GAG TAC ACG GGT GGA C. GAG TAC A–G AGT GGA D. GAG TAC ACG AGA GGAarrow_forward
- Another thalassemic patient had a mutation leading to the production of an mRNA for the β chain of hemoglobin that was 900 nucleotides longer than the normal one. The poly(A) tail of this mutant mRNA was located a few nucleotides after the only AAUAAA sequence in the additional sequence. Propose a mutation that would lead to the production of this altered mRNA.arrow_forwardConsider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forwardThe following results were obtained in early studies on the translation of secretory proteins. Based on what we now know of this process, explain the reason why each result was observed.a. An in vitro translation system consisting only of mRNA and ribosomes resulted in secretory proteins that were larger than the identical protein when translated in a cell.b. A similar system that also included microsomes produced secretory proteins that were identical in size to those found in a cell.c. When the microsomes were added after in vitro translation, the synthesized proteins were again larger than those made in a cell.arrow_forward
- The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.arrow_forwardThe MRNA for a mammalian peptide that enhances electrolyte transfer to reduce paralysis was spliced then reversed transcribed and the CDNA ligated into a phage and transfected into host bacteria cells. The host then transcribed and translated this. The protein product however was non-functional. What is the most probable reason for this result? A. Absence of post-transcriptional modification in bacterial cells B. Differences in the post-translational mechanisms in eukaryotes and prokaryotes. C. Differences in the translational mechanisms involved in prokaryotes, e.g. 70 S ribosome vs 80S ribosome. D. The mRNA did not contain a promoter region to allow peptide translation. E. Insertion of portions of the phage DNA which added sequences for amino acids changing the function of the protein product.arrow_forwardradioactively labeled cDNA is used to probe RNA isolated from kidney by Northern blotting. Twobands are seen on the blot. Which of the following reasons is least possible? A. A single pre mRNA is spliced into two different messagesB. There are two promoters for the geneC. There are two related genes expressed in kidneyD. The mRNA is cleaved in the cytoplasm as part of its degradation Explain why the answer is B or EE. There is a single mRNA produced but some is not polyadenylatedarrow_forward
- Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post transcriptional processing Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for referencearrow_forward) A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that changes the sequence to 5'- UGCCAUGGUUAAUAACACAUGAGGCGUGAAC-3'. Translate the original mRNA and the mutated mRNA and explain how insertion mutations can have dramatic effects on proteins. ( Hint; Be sure to find the initiation site).arrow_forwardNuclear (N) and cytoplasmic (C) mRNA samples of a gene with 2 exons and one intron run on an agarose gel along with a size marker, are shown in the gel figure below. Ntds = nucleotides 3. What is the length of the primary mRNA? HINT: Check question 3c RNA sample: N a. C ntds 1900- b. What is the length of the processed MRNA? 1250 1000 800- 650 с. If the 1250 nucleotide and 650 nucleotide fragments are spliced mRNA intermediates as indicated in the splicing diagram below, what is the size in nucleotides of Exon 1 & Exon 2. Size 1 Markers Exon Intran Exon pre-MRNA AG GU (1) (2) I spliced MRNA 2.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY