GENETIC ANALYSIS: AN INTEG. APP. W/MAS
2nd Edition
ISBN: 9781323142790
Author: Sanders
Publisher: Pearson Custom Publishing
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 16P
The segment of the bacterial
a. Draw the mRNA structure that forms during transcription of this segment of the
b. Label the template and coding DNA strands.
c. Explain how a sequence of this type leads to intrinsic termination of transcription.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The following bacterial DNA sequence uses the top strand as the coding strand and the bottom strand as the template strand. Write what the messenger RNA sequence for this gene would be after transcription occurs.
Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide
immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have?
5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3'
3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'
Given the following DNA sequence of the template strand for a given gene:
5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3'
Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends).
Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid.
Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
Chapter 8 Solutions
GENETIC ANALYSIS: AN INTEG. APP. W/MAS
Ch. 8 - Prob. 1PCh. 8 - 8.2 In one to two sentences each, describe the...Ch. 8 - 8.3 Answer these questions concerning...Ch. 8 - 8.4 The diagram below shows a DNA duplex. The...Ch. 8 - The following is a portion of an mRNA sequence:...Ch. 8 - Compare and contrast the properties of DNA...Ch. 8 - The DNA sequences shown below are from the...Ch. 8 - Bacterial and eukaryotic gene transcripts can...Ch. 8 - Describe the two types of transcription...Ch. 8 - What is the role of enhancer sequences in...
Ch. 8 - Prob. 11PCh. 8 - Draw a bacterial promoter and label its consensus...Ch. 8 - 13. How do SR proteins help guide premRNA intron...Ch. 8 - Three genes identified in the diagram as A, B and...Ch. 8 - Prob. 15PCh. 8 - 8.16 The segment of the bacterial gene involved in...Ch. 8 - Prob. 17PCh. 8 - Prob. 18PCh. 8 - 8.19 A DNA fragment from the end of the mouse...Ch. 8 - 8.20 Wild-type E. coli grow best at but can grow...Ch. 8 - A mutant strain of Salmonella bacteria carries a...Ch. 8 - 8.22 The human wild-type allele and a certain...Ch. 8 - Prob. 23PCh. 8 - A full-length eukaryotic gene is inserted into a...Ch. 8 - The accompanying illustration shows a portion of a...Ch. 8 - DNA footprint protection (described in Research...Ch. 8 - Suppose you have a 1-kb segment of cloned DNA that...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- b) Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts at Transcription Start Site (TSS) and terminates at the Terminator site. TSS 5'TATTATTAACGCATGACGAGCCATGCATTATCGGTATATGCACTGACCCGGRAAGGCTCCTTTTGGAGCCTTTTTT-3' 3' ATAATATTGCGTACTGCTCGGTACGTAATAGCCATATACGTGACTGGGCCTTTCCGAGGAAAACCTCGGAAAAA-5' Promoter Terminator Figure 2 Based on the double-stranded DNA sequence of terminator, draw the structure of hairpin loop that will be formed during transcription. Illustrate how the hairpin loop structure initiates the termination of transcription.arrow_forwardWhat is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'arrow_forwardb) Shown below is a short gene of an unknown bacteria genome (Figure 2). (Note: Transcription starts at Transcription Start Site (TSS).) 5'TATTATAACGCATGACGAGCCATGCATTATCGGTATATGCACTGACCCGGAAAGGCTCCTTTTGGAGCCTTTTTT-3' 3'-ATAATATTGCGTACTGCTCGGTACGTAATAGCCATATACGTGACTGGGCCTTTTCCGAGGAAAACCTCGGAAAAA-5' Promoter (i) (ii) TSS (iii) Terminator Figure 2 Which DNA strand (the top or the bottom) is used by polymerase as a DNA template? List the mechanistic steps that can trigger the initiation of transcription by the Sigma Factor. What are the amino acids translated from the resulting mRNA? Indicate the amino (NH₂*) and carboxyl (COO) termini of the polypeptide chain.arrow_forward
- The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.arrow_forwardb) Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts at Transcription Start Site (TSS) and terminates at the Terminator site. TSS 5'TATTATTAACGCATGACGAGCCATGCATTATCGGTATATGCACTGACCCGGAAGGCTCCTTTTGGAGCCTTTTI 3' ATAATATTGCGTACTGCTCGGTACGTAATAGCCATATACGTGACTGGGCCTTTCCGAGGAAAACCTCGGAAAAA-5 Promoter Terminator Figure 2 (i) Which strand of DNA (the top or the bottom) is used by RNA polymerase as a template? (ii) What are the amino acids translated from the resulting mRNA? Indicate the amino (NH3') and carboxyl (COO"') termini of the protein.arrow_forwardChoose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post transcriptional processing Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for reference 5’ CTATATTTATGTGCTATATCCAGGACTGCCCCTAGGAAATAAAAAA…AAAAAAA 3’3’ GATATAAATACACGATATAGGTCCTGACGGGGATCCTTTATTTTTT…TTTTTTT 5’arrow_forward
- b) Shown below is a short gene of an unknown bacteria genome (Figure 2). (Note: Transcription starts at Transcription Start Site (TSS).) TSS 5'-TATTATAACGCATGAGGAGCCATGCATTATCGGTATATGCACTGACCCGGAAAGGCTCCTTTTGGAGCCTTTTTT-3' 3-ATAATATTGCGTACTGCTCGGTACGTAATAGCCATATACGTGACTGGGCCTTTTCCGAGGAAAACCTCGGAAAAA-5 Promoter ********* Terminator Figure 2 Based on the DNA sequence of terminator, draw the structure of the hairpin loop that will be formed during the end of transcription.arrow_forwardThe DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ Draw boxes around any structures or bases that were added to the RNA during processing.arrow_forwardThe DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ In the DNA sequence, draw boxes around two exons in the gene. The splicing machinery does NOT pay attention to codons. The splicing of this DNA demonstrates that. How?arrow_forward
- The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ How many amino acids are in the peptide encoded by the gene? _____________arrow_forwardBelow is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.arrow_forwardThe following sequence is from a region of the M13 bacteriophage genome. Identify and label the promoter elements that would be recognized by the bacterial RNA polymerase. Where would transcription begin? CAGGCGATGATCAAATCTCCGTTGTACTTTGTTTCGCGCGTTGGTATAATCGCTGGGGTCAAGATGAGTarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY