Pearson eText Bauman Microbiology with Diseases by Body Systems -- Instant Access (Pearson+)
5th Edition
ISBN: 9780135891018
Author: ROBERT BAUMAN
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 1CT
Examine the restriction sites listed in Table 8.1 on p. 240. Which restriction enzymes produce restriction fragments with sticky ends? Which produce fragments with blunt ends?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Assume that a circular plasmid is 3200 base pairs in length and has restriction sites for HindIII restriction enzyme at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion.
Assume that a plasmid is 4700 base pairs in length and has restriction sites for a given restriction enzyme at the following locations: 800, 1400, 2900, and 3600. List the fragments by size that are ! expected when the plasmid is fully digested the restriction enzyme.
A plasmid DNA and a linear DNA (both of the same size) have one site for
a restriction endonuclease. When cut and separated on agarose gel
electrophoresis, plasmid shows one DNA band while linear DNA shows
two fragments. Explain.
Chapter 8 Solutions
Pearson eText Bauman Microbiology with Diseases by Body Systems -- Instant Access (Pearson+)
Ch. 8 - Why arent the terms recombinant DNA technology...Ch. 8 - Prob. 2TMWCh. 8 - Why wasnt polymerase chain reaction (PCR)...Ch. 8 - Why dont doctors routinely insert genes into their...Ch. 8 - Prob. 5TMWCh. 8 - Which of the following statements is true...Ch. 8 - A DNA gene synthesized from an RNA template is...Ch. 8 - Prob. 3MCCh. 8 - Prob. 4MCCh. 8 - Prob. 5MC
Ch. 8 - Prob. 6MCCh. 8 - Prob. 7MCCh. 8 - Prob. 8MCCh. 8 - Prob. 9MCCh. 8 - Prob. 10MCCh. 8 - Modified True/False 1. ________ Restriction...Ch. 8 - Modified True/False 2. ________ Restriction...Ch. 8 - Prob. 3MTFCh. 8 - Prob. 4MTFCh. 8 - Prob. 5MTFCh. 8 - Label the reagents and steps of PCR on the figure...Ch. 8 - Describe three artificial methods of introducing...Ch. 8 - Prob. 2SACh. 8 - Prob. 3SACh. 8 - Prob. 4SACh. 8 - List three potential problems of recombinant DNA...Ch. 8 - Examine the restriction sites listed in Table 8.1...Ch. 8 - CRITICAL THINKING 2 A cancer-inducing virus,...Ch. 8 - A thermocycler uses DNA polymerase from...Ch. 8 - Prob. 4CTCh. 8 - Prob. 5CTCh. 8 - Prob. 6CTCh. 8 - Prob. 7CTCh. 8 - Prob. 8CTCh. 8 - Prob. 9CTCh. 8 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Lane 5 in the gel above displays the pBashi cleavage products after restriction digest with the restriction enzymes Xhol+ Pstl. Lane 6 in the gel above displays the pBashi cleavage products after restriction digest with the restriction enzymes Xhol+ HindlII+ Pstl. label on the plasmid. i) The location of the Pstl site ii) The sizes of the new fragments made by this Pstl cutarrow_forwardplease do only part D .arrow_forwardA small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis.The following data were obtained. (a) Is the original molecule linear or circular?(b) Draw a map of restriction sites (showing distances between sites) that isconsistent with the data given.(c) How many additional maps are compatible with the data?(d) What would have to be done to locate the cleavage sites unambiguouslywith respect to each other?arrow_forward
- 2(a) ivarrow_forwardThe map of plasmid pUC19 is shown below. The restriction site coordinate is the position of the 5’base on the top strand of each site sequence. The restriction enzyme sites are in bold type if there is only one site in pUC19. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme PvuII. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme DrdI.arrow_forwardSingle and double digestion of plasmid pJC716 were performed using the restriction enzymes EcoRI and BamHI. DNA fragments were shown in an electrophoretogram below. Construct a restriction map of plasmid pJC716 for enzymes EcoRI and BamHI.arrow_forward
- What does it mean if a restriction enzyme produces ‘sticky’ or ‘blunt’ ends? Does the restriction enzyme HaeIII produce “sticky” ends or “blunt” ends?arrow_forwardUsing the restriction site for SalI, suggest another restriction enzyme that would cut at the same site.arrow_forwardSingle and double digestion of plasmid pMCS326 were performed using the restriction enzymes AluIII and EcoRV. DNA fragments were shown in an electrophoretogram below. Construct a restriction map of plasmid pMCS326 for enzymes AluIII and EcoRV. (Create restriction mapping with explanation)arrow_forward
- A) For this DNA fragment (from 5' to 3') "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary strand B) What are the products when the DNA with the above sequence is incubated with the restriction enzyme EcoRI C) What are the products when the DNA with the above sequence is incubated with the restriction enzyme Mspl D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key elements of the molecule including the bonds involvedarrow_forwardYou plan to clone exon 11 of the HEXA gene (Section C) into the multiple cloning site (MCS) of the plasmid vector pUC19 illustrated below. You PCR amplify only the 184 bp DNA region representing exon 11 of HEXA from human DNA as a blunt-ended dsDNA fragment, and purify the amplicon. Next you digest the vector pUC19 with the restriction enzyme (RE) Smal to obtain linear plasmid DNA. You mix the PCR product and linear plasmid, add some DNA ligase enzyme in an appropriate buffer, and incubate overnight at 16°C. The ligation mixture is used to transform competent E. coli cells, which are subsequently streaked out onto agar plates containing ampicillin, X-gal and IPTG. HEXA exon 11 sequence: attcagccagacacaatcatacaggtgtggcgagaggatattccagtgaactatatgaaggagctggaactggtc accaaggccggcttccgggcccttctctctgccccctggtacctgaaccgtatatcctatggccctgactggaag gatttctacatagtggaacccctggcatttgaag PUC 19 plasmid map: 2686 1 Amp 0 lacZ EcoRI (390) Smal (410) BamHI (420) MCS Kpnl (430) LacR binding site Plac Pstl…arrow_forwardThis is a restriction map for the 250 base pair plasmid pSage. Restriction sites for the restriction endonuclease Nhel are 7, 69 and 160. What are the sizes of the restriction fragments produced? Check all that apply. p SAGE Nhel 7 250 bp Nhền 160 Nhel 69 62 69 91 160 97arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Enzyme Kinetics; Author: MIT OpenCourseWare;https://www.youtube.com/watch?v=FXWZr3mscUo;License: Standard Youtube License