Pearson eText Bauman Microbiology with Diseases by Body Systems -- Instant Access (Pearson+)
5th Edition
ISBN: 9780135891018
Author: ROBERT BAUMAN
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 1CT
Examine the restriction sites listed in Table 8.1 on p. 240. Which restriction enzymes produce restriction fragments with sticky ends? Which produce fragments with blunt ends?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each strand of DNA. What is the advantage ofhaving restriction sites organized this way?
Lane 5 in the gel above displays the pBashi cleavage products after restriction digest with the restriction enzymes Xhol+ Pstl. Lane 6 in the gel above displays the pBashi cleavage products after restriction digest with the restriction enzymes Xhol+ HindlII+ Pstl. label on the plasmid. i) The location of the Pstl site ii) The sizes of the new fragments made by this Pstl cut
please do only part D .
Chapter 8 Solutions
Pearson eText Bauman Microbiology with Diseases by Body Systems -- Instant Access (Pearson+)
Ch. 8 - Why arent the terms recombinant DNA technology...Ch. 8 - Prob. 2TMWCh. 8 - Why wasnt polymerase chain reaction (PCR)...Ch. 8 - Why dont doctors routinely insert genes into their...Ch. 8 - Prob. 5TMWCh. 8 - Which of the following statements is true...Ch. 8 - A DNA gene synthesized from an RNA template is...Ch. 8 - Prob. 3MCCh. 8 - Prob. 4MCCh. 8 - Prob. 5MC
Ch. 8 - Prob. 6MCCh. 8 - Prob. 7MCCh. 8 - Prob. 8MCCh. 8 - Prob. 9MCCh. 8 - Prob. 10MCCh. 8 - Modified True/False 1. ________ Restriction...Ch. 8 - Modified True/False 2. ________ Restriction...Ch. 8 - Prob. 3MTFCh. 8 - Prob. 4MTFCh. 8 - Prob. 5MTFCh. 8 - Label the reagents and steps of PCR on the figure...Ch. 8 - Describe three artificial methods of introducing...Ch. 8 - Prob. 2SACh. 8 - Prob. 3SACh. 8 - Prob. 4SACh. 8 - List three potential problems of recombinant DNA...Ch. 8 - Examine the restriction sites listed in Table 8.1...Ch. 8 - CRITICAL THINKING 2 A cancer-inducing virus,...Ch. 8 - A thermocycler uses DNA polymerase from...Ch. 8 - Prob. 4CTCh. 8 - Prob. 5CTCh. 8 - Prob. 6CTCh. 8 - Prob. 7CTCh. 8 - Prob. 8CTCh. 8 - Prob. 9CTCh. 8 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis.The following data were obtained. (a) Is the original molecule linear or circular?(b) Draw a map of restriction sites (showing distances between sites) that isconsistent with the data given.(c) How many additional maps are compatible with the data?(d) What would have to be done to locate the cleavage sites unambiguouslywith respect to each other?arrow_forwardThe map of plasmid pUC19 is shown below. The restriction site coordinate is the position of the 5’base on the top strand of each site sequence. The restriction enzyme sites are in bold type if there is only one site in pUC19. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme PvuII. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme DrdI.arrow_forwardA) For this DNA fragment (from 5' to 3') "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary strand B) What are the products when the DNA with the above sequence is incubated with the restriction enzyme EcoRI C) What are the products when the DNA with the above sequence is incubated with the restriction enzyme Mspl D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key elements of the molecule including the bonds involvedarrow_forward
- You plan to clone exon 11 of the HEXA gene (Section C) into the multiple cloning site (MCS) of the plasmid vector pUC19 illustrated below. You PCR amplify only the 184 bp DNA region representing exon 11 of HEXA from human DNA as a blunt-ended dsDNA fragment, and purify the amplicon. Next you digest the vector pUC19 with the restriction enzyme (RE) Smal to obtain linear plasmid DNA. You mix the PCR product and linear plasmid, add some DNA ligase enzyme in an appropriate buffer, and incubate overnight at 16°C. The ligation mixture is used to transform competent E. coli cells, which are subsequently streaked out onto agar plates containing ampicillin, X-gal and IPTG. HEXA exon 11 sequence: attcagccagacacaatcatacaggtgtggcgagaggatattccagtgaactatatgaaggagctggaactggtc accaaggccggcttccgggcccttctctctgccccctggtacctgaaccgtatatcctatggccctgactggaag gatttctacatagtggaacccctggcatttgaag PUC 19 plasmid map: 2686 1 Amp 0 lacZ EcoRI (390) Smal (410) BamHI (420) MCS Kpnl (430) LacR binding site Plac Pstl…arrow_forwardThis is a restriction map for the 250 base pair plasmid pSage. Restriction sites for the restriction endonuclease Nhel are 7, 69 and 160. What are the sizes of the restriction fragments produced? Check all that apply. p SAGE Nhel 7 250 bp Nhền 160 Nhel 69 62 69 91 160 97arrow_forwardA new restriction enzyme is discovered. It recognizes a 6 base pair pallindromic sequence. The first three bases of the target sequence are are given below with the cut identified by ^. Answer the following questions: Target sequence: 5' G^TA _ _ _ 3'3' _ _ _ _ _ _ 5' 1) Complete the target sequence with all missing bases. Also include the position of the cut in the lower sequence(^) 2) What kind of clevage does the enzyme use?arrow_forward
- The sequences below indicated the 6bp recognition site for the restriction enzyme EcoRI. The lines indicate the sites where the enzyme will cut each strand. 1). write the sequence and structure of the two DNA pieces after the enzyme cuts (hydrogen bonds holding the strands together between the lines are broken after enzyme cuts) 2). indicate whether EcoRI generates blunt or sticky overhangs 5'- G I A A T T C - 3' 3' - C T T A A l G - 5'arrow_forwardYou want to insert a sequence in the lacI gene to alter its function,what restriction enzyme(s) will you use?Indicate 1 or 2restriction enzyme(s) that you will use on the gene to show the cut.arrow_forwardA molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is 62% G + C. How many times, on average, are restriction sites for the following restriction enzymes likely to be present in this DNA molecule? a. HindIII (recognition sequence is AAGCTT)arrow_forward
- You want to insert a sequence in the lacI gene to alter its function,what restriction enzyme(s) will you use?Indicate 1 or 2restriction enzyme(s) that you will use on the gene to show the cutarrow_forwardRestriction endonucleases are bacterial enzymes that cleave duplex (double-stranded) DNA at specific nucleotide sequences. The mode of replication of the animal virus SV40 has been investigated by using restriction endonucleases that cleave SV40 DNA into a number of unique segments. Like most viruses, SV40 DNA is circular. The map positions of the 11 fragments produced by a pair of restriction endonucleases are shown on the next page. Immediately following a 5 or 10 minute pulse of radioactively labeled thymidine, labeled SV40 molecules that have completed replication during the pulse are isolated. These newly replicated DNA molecules are digested by the restriction endonucleases and the resulting fragments are analyzed for the relative amounts of pulse label they contain. The results are in the table below. Assume that at the time the label was added there was a random population of replicating SV40 DNA molecules in all possible stages of synthesis. From the information given below,…arrow_forwardA 12 kb linear DNA fragment is subject to single or double RE digest and agarose gelelectrophoresis, to yield the gel profile shown below. The first lane contains the size marker(M).a) Explain how the name of the enzyme EcoRI is derived.b) How many sites are there for EcoRI and PvuII respectively on this DNA fragment?c) Use the sizes of the DNA bands on the gel to compile a restriction enzyme map of the DNAfragment. Indicate the positions of the restriction enzymes sites for EcoRI and PvuII on themap.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Enzyme Kinetics; Author: MIT OpenCourseWare;https://www.youtube.com/watch?v=FXWZr3mscUo;License: Standard Youtube License