
Foundations in Microbiology
9th Edition
ISBN: 9780073522609
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7.L1, Problem 8MCQ
Summary Introduction
Introduction:
Osmosis and facilitated diffusion are both types pf passive transport. The inherent energy of the molecules moving down a gradient does the work of transport.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 7 Solutions
Foundations in Microbiology
Ch. 7.1 - 1. Describe the major environmental factors to...Ch. 7.1 - 2. Define nutrition and nutrients and their...Ch. 7.1 - 3. Differentiate between organic and inorganic...Ch. 7.1 - Prob. 4ELOCh. 7.1 - Prob. 1CYPCh. 7.1 - Prob. 2CYPCh. 7.1 - 3. List the general functions of the essential...Ch. 7.1 - 4. Define growth factors and metallic ions with...Ch. 7.2 - 5. Describe the main categories of nutritional...Ch. 7.2 - 6. Distinguish different types of autotrophs and...
Ch. 7.2 - Prob. 7ELOCh. 7.2 - 5. Compare autotrophs and heterotrophs with...Ch. 7.2 - 6. Describe the nutritional strategy of two types...Ch. 7.2 - Prob. 7CYPCh. 7.2 - Prob. 8CYPCh. 7.3 - 8. Describe the basic factors in diffusion and...Ch. 7.3 - Prob. 9ELOCh. 7.3 - 10. Analyze adaptations microbes make in response...Ch. 7.3 - Prob. 11ELOCh. 7.3 - 9. Compare and contrast passive and active forms...Ch. 7.3 - Prob. 10CYPCh. 7.3 - 11. Explain the differences between facilitated...Ch. 7.3 - 12. Compare the effects of isotonic, hypotonic,...Ch. 7.4 - 12. Differentiate between habitat and niche.Ch. 7.4 - 13. Describe the range of temperatures a microbe...Ch. 7.4 - Prob. 14ELOCh. 7.4 - Prob. 15ELOCh. 7.4 - Prob. 16ELOCh. 7.4 - Prob. 17ELOCh. 7.4 - Prob. 13CYPCh. 7.4 - Prob. 14CYPCh. 7.4 - 15. Explain what it means to be an obligate...Ch. 7.4 - 16. Where in the body are anaerobic habitats apt...Ch. 7.4 - Prob. 17CYPCh. 7.5 - 18. Outline the types of associations among...Ch. 7.5 - Prob. 19ELOCh. 7.5 - Prob. 20ELOCh. 7.5 - Prob. 21ELOCh. 7.5 - Prob. 22ELOCh. 7.5 - Prob. 18CYPCh. 7.5 - Prob. 19CYPCh. 7.5 - Prob. 20CYPCh. 7.5 - 21. Relate several advantages to communication...Ch. 7.6 - Prob. 23ELOCh. 7.6 - 24. Describe the process of population growth and...Ch. 7.6 - 25. Explain the stages in the population growth...Ch. 7.6 - Prob. 26ELOCh. 7.6 - 22. What is microbial growth? Explain the stages...Ch. 7.6 - 23. Why is growth called exponential? What causes...Ch. 7.6 - 24. Contrast two different methods of detecting...Ch. 7.6 - 25. Explain the relationship between colony counts...Ch. 7.L1 - 1. An organic nutrient essential to an...Ch. 7.L1 - Prob. 2MCQCh. 7.L1 - 3. An organism that can synthesize all its...Ch. 7.L1 - Prob. 4MCQCh. 7.L1 - Prob. 5MCQCh. 7.L1 - 6. Which of the following substances are required...Ch. 7.L1 - 7. A pathogen would most accurately be described...Ch. 7.L1 - Prob. 8MCQCh. 7.L1 - Prob. 9MCQCh. 7.L1 - Prob. 10MCQCh. 7.L1 - Prob. 11MCQCh. 7.L1 - 12. Which of the following is not involved in...Ch. 7.L1 - 13. Superoxide ion is toxic to strict anaerobes...Ch. 7.L1 - Prob. 14MCQCh. 7.L1 - 15. In a viable plate count, each ____ represents...Ch. 7.L1 - 16. The stage in population growth with the...Ch. 7.L1 - Prob. 1CSRCh. 7.L1 - Prob. 2CSRCh. 7.L1 - Prob. 3CSRCh. 7.L1 - Prob. 1WCCh. 7.L1 - Prob. 2WCCh. 7.L1 - Prob. 3WCCh. 7.L1 - Prob. 4WCCh. 7.L1 - 5. a. What biochemical events in quorum sensing...Ch. 7.L1 - 6. Explain what is happening to the population at...Ch. 7.L1 - Prob. 7WCCh. 7.L2 - 1. a. Is there a microbe that could grow on a...Ch. 7.L2 - 2. Describe how one might determine the nutrient...Ch. 7.L2 - 3. Patients with ketoacidosis associated with...Ch. 7.L2 - Prob. 4CTCh. 7.L2 - 5. Provide some suggestions for treating anaerobic...Ch. 7.L2 - Prob. 6CTCh. 7.L2 - Prob. 7CTCh. 7.L2 - Prob. 8CTCh. 7.L2 - 9. Describe the similarities and differences...Ch. 7.L2 - 1. Place appropriate points on the axes and draw...Ch. 7.L2 - Prob. 2VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Immune System and Immune Response Animation; Author: Medical Sciences Animations;https://www.youtube.com/watch?v=JDdbUBXPKc4;License: Standard YouTube License, CC-BY
Immune response: summary; Author: Dr Bhavsar Biology;https://www.youtube.com/watch?v=ADANgHkX4OY;License: Standard Youtube License